Thursday July 31 2008 |
Time | Replies | Subject |
11:28PM |
1 |
clustering and data-mining... |
10:41PM |
0 |
multiple comparison |
9:29PM |
2 |
Help with hazard plots |
9:22PM |
1 |
anisotropy in vgm model. HELP!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! |
9:21PM |
2 |
dput vs unclass to see what a factor really is composed of |
9:19PM |
2 |
allocMatrix limits |
9:18PM |
2 |
sort rows of matrix by rows of another matrix |
8:40PM |
3 |
cutting out numbers from vectors |
8:30PM |
1 |
strip names lattice graphics |
8:20PM |
1 |
Randomly drawing observations from factors. |
8:07PM |
4 |
instal tar.gz package on windows |
8:05PM |
0 |
vertical bpplot |
7:54PM |
1 |
bwplot with Date object |
7:51PM |
1 |
'system' command through Rserve |
7:36PM |
1 |
rollapply() to portions of a matrix |
6:47PM |
2 |
How to output R image to a file? |
6:17PM |
0 |
anisotrophy in fit.variogram problem |
5:24PM |
5 |
Random number generation |
5:11PM |
0 |
hwriter - Writing R objects in HTML format |
4:08PM |
0 |
Sperman Correlation with rcorr (Hmisc) |
4:05PM |
3 |
Code to calculate internal rate of return |
1:53PM |
0 |
Identifying Points That Belongs to Components of Mixture Models |
11:31AM |
1 |
nls weights warning message |
11:11AM |
4 |
Identifying common prefixes from a vector of words, and delete those prefixes |
10:20AM |
0 |
OT:Selling Data Mining Cloud-A Concept |
9:31AM |
0 |
random effects mixed model, different regressors |
9:29AM |
1 |
combinations with replications |
9:10AM |
1 |
add string |
4:46AM |
2 |
stats question |
4:38AM |
1 |
High resolution graphics from R Windows Vista |
4:17AM |
0 |
Generic plot function for GLM objects |
4:12AM |
1 |
Rearranging Data |
4:02AM |
1 |
multiple separators in scan() functions |
3:37AM |
1 |
predict rpart: new data has new level |
2:40AM |
2 |
S 3 generic method consistency warning please help |
2:36AM |
1 |
colnames from read.table |
1:29AM |
0 |
High resolution graphics from Windows Vista |
12:53AM |
0 |
curva PI |
12:29AM |
0 |
Is conditional evaluation of R code chunks possible in Sweave ? |
|
Wednesday July 30 2008 |
Time | Replies | Subject |
11:19PM |
1 |
dotFirst option |
10:43PM |
1 |
question about krige code in R |
10:14PM |
1 |
barplot for a categorial variable |
9:48PM |
2 |
Sampling two exponentials |
7:52PM |
1 |
Converting to subscripts and superscripts |
7:04PM |
1 |
Setting fixed size for segement plot using stars() (axes size vs print size) |
6:27PM |
2 |
john chambers R book |
6:27PM |
2 |
System exit codes |
6:18PM |
3 |
Random subset |
6:12PM |
5 |
History pruning |
5:54PM |
1 |
setting editor environment variable EDITOR either when configuring R for installation or in .Rprofile |
5:22PM |
1 |
Variable name in a String |
5:04PM |
1 |
best quad core configuration? |
4:56PM |
1 |
Hello, |
4:47PM |
1 |
bug in 'margins' behavior in reshape - cast |
4:45PM |
0 |
OT: Data mining on demand .Using cloud computers. |
4:30PM |
0 |
FOURIER TRANSFORM HELP |
4:09PM |
0 |
Axes in perspective plot - persp() |
3:18PM |
0 |
Percent Change After Each Interval |
2:56PM |
1 |
Rprintf will not build in my C++ compiler |
1:54PM |
1 |
model mix problem. FALSE CONVERGENCE |
1:48PM |
1 |
odds ratios in multiway tables (stratified) |
1:41PM |
1 |
Unexpected line type in lattice plot key on pdf device |
1:39PM |
2 |
R -Legality Question about R's Open Source GNU GPL License |
1:11PM |
1 |
adding lines to multiple plot |
12:36PM |
0 |
Connecting R to PostgreSQL on Windows. |
12:18PM |
0 |
"dens" function |
11:59AM |
1 |
Re creating Procrustes Plot in Lattice |
11:14AM |
2 |
FFT - (STATS) - is this correct? |
11:03AM |
1 |
Mixed effects model where nested factor is not the repeated across treatments lme??? |
10:41AM |
0 |
adding lines to multiple plots |
10:37AM |
0 |
png() does not generate a 24 bit PNG file |
10:34AM |
0 |
glm error: factor levels |
9:54AM |
2 |
Bizarre - R crashes on merge |
9:50AM |
1 |
function to transform response of a formula |
9:38AM |
1 |
read XML |
9:31AM |
0 |
R GUI help |
9:24AM |
2 |
problem with read.table() |
8:53AM |
6 |
Need help |
8:44AM |
1 |
need some help |
8:28AM |
2 |
Eclipse/Statet: How to set breakpoints |
8:21AM |
0 |
Successfully connected GNU R to PostgreSQL on windows XP. |
7:49AM |
1 |
problem with nested loops |
7:44AM |
1 |
~ . help |
4:58AM |
2 |
Repeated Measure ANOVA-Old question |
12:32AM |
2 |
how to get the position of a vector-value |
|
Tuesday July 29 2008 |
Time | Replies | Subject |
10:41PM |
1 |
What's the best way to operate R from within Excel? |
10:20PM |
1 |
Is there a better way to check if an element of a list exists than using match on names? |
10:15PM |
1 |
rolling regression between adjacent columns |
10:04PM |
3 |
placing a text in the corner of a plot |
9:58PM |
1 |
correlation between matrices - both with some NAs |
7:40PM |
0 |
optimize simultaneously two binomials inequalities using nlm |
7:23PM |
2 |
R command history -- can it be like Matlab's? |
6:12PM |
3 |
finding a faster way to do an iterative computation |
6:12PM |
0 |
Flexible semivariogram in R (HELP) |
5:45PM |
1 |
List names help |
5:30PM |
0 |
Major Cloud Computing Testbed Announced at University of Illinois |
4:56PM |
2 |
accessing list elements |
4:55PM |
3 |
try question |
4:38PM |
4 |
Graphics function question |
4:36PM |
1 |
ls() and memory question |
4:28PM |
3 |
table questions |
4:27PM |
0 |
Question regarding statisticians |
4:12PM |
1 |
more environment questions |
4:11PM |
0 |
Bootstraping GAMs for confidence intervales calculation |
4:00PM |
1 |
tensor product of equi-spaced B-splines in the unit square |
3:37PM |
1 |
Removing script file |
3:36PM |
0 |
subscript out of bounds help |
3:28PM |
2 |
biplot_group_colours_and_point_symbols |
3:26PM |
0 |
subscript out of bounds error. |
2:51PM |
2 |
Most often pairs of chars across grouping variable |
2:09PM |
2 |
About clustering techniques |
2:03PM |
1 |
Howto Draw Bimodal Gamma Curve with User Supplied Parameters |
1:01PM |
1 |
combining zoo series with an overlapping index? |
11:55AM |
2 |
'for' loop, two variables |
11:42AM |
1 |
optim fails when using arima |
11:38AM |
0 |
stringdot ? |
11:34AM |
2 |
Panel of pie charts |
11:14AM |
0 |
mac install no font found problem in quartz display |
10:32AM |
0 |
max |
10:10AM |
2 |
FW: Installing BRugs |
9:51AM |
1 |
Bug in sd() and var() in handling vectors of NA (R version 2.7.1)? |
9:24AM |
1 |
keywords |
8:49AM |
1 |
Problem reading a particular file with read.spss() |
7:37AM |
1 |
How to set the parameters in Trellis Graphics (by Lattice package) |
5:00AM |
1 |
list |
4:23AM |
2 |
Is there anyway to clip the bottom of a barplot? |
4:14AM |
2 |
Help interpreting density(). |
2:04AM |
1 |
environment question |
12:58AM |
0 |
"wave model" semivariogram |
|
Monday July 28 2008 |
Time | Replies | Subject |
10:42PM |
1 |
Is there a way to avoid loading dependendent packages? |
10:41PM |
2 |
Rf_error crashes entire program. |
8:24PM |
1 |
loop does not work |
7:36PM |
1 |
How to unsubscribe? |
7:15PM |
3 |
Is there way to multiple plots on gap.plot? |
6:34PM |
1 |
Negative Binomial Regression |
6:32PM |
7 |
Legality Question about R's Open Source GNU GPL License |
6:10PM |
3 |
Fill in NA values in vector with previous character/factor |
5:36PM |
3 |
Case statements in R |
5:07PM |
0 |
Question about the SSOAP package |
4:57PM |
1 |
Overlay of simple plots |
4:53PM |
5 |
rollapply() opertation on ts matrix |
4:14PM |
1 |
multiv |
3:59PM |
1 |
RStem with portuguese language |
3:47PM |
0 |
Bootstrapping |
2:54PM |
2 |
writing the plots |
2:44PM |
4 |
RODBC to query an Oracle table |
1:32PM |
2 |
how to add notes to the graph? |
1:15PM |
3 |
speeding up loop and dealing wtih memory problems |
12:38PM |
0 |
Rv: Chi-square parameter estimation |
12:28PM |
0 |
randomSurvivalForest 3.5.0 now available |
12:14PM |
1 |
Converting from char to POSIX: |
10:19AM |
2 |
axis.break on Date-x-axis in lattice xyplot |
9:43AM |
0 |
Help with yaImpute |
8:54AM |
0 |
I can not see help.start() in Ubuntu. |
6:08AM |
1 |
How to set directory Rscript runs in/Sweave output directory |
5:21AM |
1 |
Are there any packages that can process images other than pixelmap (i.e. pnm)? |
4:20AM |
2 |
Help with a loop |
3:26AM |
2 |
read.table question |
2:06AM |
1 |
Mixed model question. |
12:32AM |
2 |
Converting english words to numeric equivalents |
12:12AM |
1 |
Interpolating a line and then summing there values for a diurnal oxygen curve (zoo object) |
|
Sunday July 27 2008 |
Time | Replies | Subject |
10:29PM |
0 |
Rolling regression - o/p selected coefficients |
10:20PM |
4 |
product of successive rows |
8:32PM |
1 |
help with durbin.watson |
7:39PM |
1 |
64-bit R on Mac OS X 10.5.4 |
7:36PM |
0 |
Fitting a Bivariate Poisson log-normal distribution |
7:10PM |
2 |
Colors in Sweave |
6:51PM |
2 |
Link functions in SEM |
6:29PM |
2 |
equivalent R functions for Numerical Recipes fitxy and fitexy ? |
2:24PM |
0 |
competing risk model with time dependent covariates under R or Splus |
11:55AM |
4 |
Object-oriented programming in R for Java programmers? |
11:01AM |
0 |
re sponse surface analysis |
7:45AM |
1 |
Color of box frame in Legend (Was: Matrix barplot) |
7:39AM |
1 |
A easy way to write formula |
7:34AM |
1 |
Retain plot? |
7:05AM |
1 |
Complex to polar? |
5:00AM |
1 |
Lattice wireframe: How to avoid drawing lines around polygons when using shade=TRUE |
4:39AM |
1 |
Transfer Function Modeling |
|
Saturday July 26 2008 |
Time | Replies | Subject |
11:07PM |
1 |
Coarsening the Resolution of a Dataset |
9:42PM |
2 |
Spatial Sample |
9:26PM |
4 |
Data length mismatch. |
9:12PM |
2 |
Sample |
8:26PM |
2 |
GLS "no terms component" error |
4:00PM |
1 |
Can't get the correct order from melt.data.frame of reshape library. |
3:37PM |
2 |
Beginning lm |
3:30PM |
1 |
Marking Interval Length |
3:24PM |
0 |
.Rprofile in RFrameworks? |
3:17PM |
1 |
issues with gap.plot function |
3:16PM |
1 |
Add a Vector to a Matrix |
2:19PM |
1 |
Remove non-numerical columns from data frame |
12:43PM |
0 |
competing risk model with time dependent covariates |
11:47AM |
2 |
response surface analysis |
11:40AM |
1 |
S-PLUS code in R |
9:59AM |
0 |
Help to Text Windoes in Menu with TCL-TK |
9:08AM |
0 |
gam() of package "mgcv" and anova() |
4:52AM |
1 |
error in test |
4:06AM |
1 |
Simple vector question. |
3:30AM |
1 |
Help with matrix |
12:07AM |
1 |
64-bit R on Mac OS X 10.4.5 |
12:00AM |
4 |
parametric bootstrap |
|
Friday July 25 2008 |
Time | Replies | Subject |
10:43PM |
0 |
fit.dist gnlm question, NaN and Inf results |
9:54PM |
1 |
Thin frame line around R pdf output in LaTeX |
9:32PM |
1 |
Matrix from List |
9:18PM |
0 |
Error in vector("double", length) |
9:06PM |
3 |
Numerical question |
8:28PM |
1 |
How to pass function argument of same name to internal call? |
8:20PM |
0 |
R-pmg (poor man gui) question |
8:01PM |
2 |
graphing regression coefficients and standard errors |
7:50PM |
0 |
Pairs() function: selective changing of ylim; use of key |
7:39PM |
0 |
s-plus in R... simpler code |
7:31PM |
1 |
Selecting the first measurement only from a longitudinal sequence |
7:23PM |
1 |
Percentile Estimation From Kernel Density Estimate |
7:01PM |
1 |
create multi windows plot at the same time |
6:49PM |
0 |
need help in parametric bootstrap |
6:24PM |
1 |
transcript a matlab code in R |
6:13PM |
1 |
Minor Bug in Documentation of merge() |
4:13PM |
1 |
plot zoo custom panel help |
3:52PM |
1 |
Interactive plot using playwith() and abline |
2:49PM |
3 |
melting a list: basic question |
2:41PM |
0 |
Package np version 0.20-0 released to CRAN |
2:27PM |
1 |
Saving a workspace with "extras"? |
2:27PM |
1 |
Insert rows into a pre-existing data frame |
2:03PM |
1 |
Chi-square parameter estimation |
1:53PM |
0 |
"Multiple" Regressions indexed by goodness of fit |
1:40PM |
1 |
S4 class and Package NAMESPACE [NC] |
1:23PM |
1 |
Scatterplot matrix one column vs. the rest of the dataset |
1:08PM |
1 |
Plink bed files |
1:07PM |
3 |
Maximization under constraits |
12:51PM |
1 |
extracting Pr>ltl from robcov/ols (Design) |
12:49PM |
0 |
Errror in running R2.7.1 version to R2.6.2 version |
12:40PM |
1 |
pca |
12:13PM |
4 |
Matrix barplot |
11:03AM |
1 |
Write lower half of distance matrix only |
10:33AM |
1 |
Building a data frame with missing data |
10:29AM |
1 |
Tutorial on rgl Graphics |
10:26AM |
1 |
cannot allocate vector of size... |
9:36AM |
0 |
Three contrast matrices on the same linear model |
9:34AM |
0 |
glht after lmer with "$S4class-" and "missing model.matrix-" errors with DATA |
9:27AM |
1 |
glht after lmer with "$S4class-" and "missing model.matrix-" errors |
9:07AM |
3 |
Help with rep |
9:02AM |
0 |
discrete event simulation - "factory" with rework |
8:54AM |
2 |
Package Hmisc, functions summary.formula() and latex(), options pdig, pctdig, eps and prmsd |
6:34AM |
2 |
problem in choosing cran mirror ! |
6:19AM |
2 |
Fit a 3-Dimensional Line to Data Points |
3:26AM |
1 |
Installation error for RCurl in Redhat enterrpise 5 |
3:19AM |
3 |
Bug in gap.plot |
3:02AM |
0 |
nlminb--lower bound for parameters are dependent on each others |
2:03AM |
1 |
Relying on R to generate html tables with hyperlinks and pictures ? |
1:13AM |
1 |
Create an R package |
1:07AM |
2 |
Rolling range and regression calculations |
12:46AM |
2 |
How to preserve the numeric format and digits ? |
|
Thursday July 24 2008 |
Time | Replies | Subject |
11:35PM |
2 |
simple random number generation |
10:40PM |
0 |
ANNOUNCE: rapache 1.1.0 release |
10:25PM |
0 |
OT: course in research administration |
10:09PM |
1 |
Installing R packages in Textmate |
10:07PM |
3 |
Integrating R and Textmate |
9:58PM |
1 |
still more dumb questions |
8:29PM |
3 |
Should this PDF render correctly without font embedding? |
8:25PM |
0 |
SPR experiment: using lmer, transforming data, collinearity, and using a covariable |
8:19PM |
1 |
Cairo graphics |
8:13PM |
1 |
ggplot2 help |
7:19PM |
2 |
factor question |
6:04PM |
0 |
Problem with GLS dwtest function |
5:42PM |
1 |
R-package install |
5:37PM |
1 |
Parallel Processing and Linear Regression |
5:13PM |
1 |
Formatting Syntax when Merging |
3:31PM |
2 |
Help with which() |
3:30PM |
2 |
What is wrong with this contrast matrix? |
2:55PM |
1 |
[Fwd: Re: Coefficients of Logistic Regression from bootstrap - how to get them?] |
2:06PM |
1 |
Error - unable to load shared library |
2:00PM |
5 |
How to delete duplicate cases? |
1:57PM |
4 |
Dividing by 0 |
1:47PM |
1 |
how know the status of particular process |
1:36PM |
0 |
Multinomial logistic regression with non-numerical data. |
12:59PM |
3 |
incrementing for loop by 2 |
12:09PM |
2 |
NAs - NAs are not allowed in subscripted assignments |
12:02PM |
1 |
Problem with scatterplot3d example |
11:07AM |
0 |
Problems with Rmpi and LAM 7.1.4 |
11:01AM |
4 |
Just 2 more questions - for now! |
10:55AM |
0 |
Bootstraping GAMs: confidence intervals |
10:38AM |
0 |
unable to load a library |
10:30AM |
4 |
Is there an equivalent * operator? |
10:04AM |
1 |
How to get rule number in arules |
9:54AM |
1 |
Coconut benchmark for R? |
8:59AM |
1 |
time zone - best way to shift hours |
7:23AM |
1 |
ggplot question |
6:23AM |
1 |
convert a vector of words into a matrix |
3:18AM |
2 |
Can R fill in missing values? |
1:29AM |
3 |
how to export ".xls" file with colorful cells? |
|
Wednesday July 23 2008 |
Time | Replies | Subject |
11:02PM |
1 |
Aggregating zoo object with NAs in multiple column |
10:51PM |
2 |
path and R CMD check |
10:03PM |
0 |
Simulating multilevel responses |
9:53PM |
3 |
how can I write code to detect whether the machine is Windows or Linux? |
9:49PM |
1 |
R2WinBUGS problem |
8:55PM |
2 |
Weighted variance function? |
8:33PM |
4 |
Using PrettyR to produce LaTeX output |
7:45PM |
0 |
pvclust |
7:41PM |
2 |
truncated normal |
7:39PM |
3 |
Constrained coefficients in lm (correction) |
7:35PM |
0 |
Constrained coefficients in lm |
7:24PM |
0 |
Fw: Using if, else statements |
7:12PM |
2 |
Point-biserial correlation |
7:03PM |
1 |
Sample on dataframe |
6:49PM |
1 |
Questions on weighted least squares |
6:47PM |
1 |
Q re iterating a process and appending results to output file |
6:29PM |
5 |
Histogram |
5:43PM |
3 |
sum each row and output results |
4:23PM |
2 |
Flip Matrix form file? |
4:20PM |
2 |
shQuote and cat |
4:05PM |
2 |
Warning message in if else statement |
3:44PM |
6 |
Using if, else statements |
3:12PM |
2 |
Using RODBC to use SQL queries |
2:06PM |
1 |
Calling LISP programs in R |
2:03PM |
8 |
sequential sum of a vector... |
1:49PM |
0 |
How to control the memory? |
1:23PM |
6 |
Convert list of lists <--> data frame |
1:14PM |
1 |
[Fwd: Re: Coefficients of Logistic Regression from bootstrap - how to get them?] |
1:07PM |
3 |
Quantitative analysis of non-standard scatter plots. |
12:55PM |
1 |
Time series reliability questions |
12:54PM |
18 |
Simple... but... |
10:39AM |
3 |
maximum likelihood method to fit a model |
9:56AM |
6 |
par() function does not work |
8:21AM |
1 |
Combining 4th column from 30 files |
7:06AM |
1 |
mle2(): logarithm of negative pdfs |
4:07AM |
0 |
rpart node number |
3:43AM |
2 |
Can't Load Text Files |
2:02AM |
1 |
select significant variables |
1:57AM |
3 |
average replicate probe values |
1:54AM |
1 |
an extremely simple question |
1:12AM |
0 |
deblur microscope image stacks |
12:22AM |
1 |
rpart confidence intervals? |
|
Tuesday July 22 2008 |
Time | Replies | Subject |
11:05PM |
2 |
Plotting Multiple lines on one plot |
10:40PM |
2 |
F test |
9:49PM |
1 |
TextMate and R |
8:31PM |
2 |
How to.... |
8:28PM |
1 |
Reading the data from specific columns |
8:22PM |
2 |
Cannot re-start R after bus error |
8:18PM |
2 |
Decoding subscripts/superscripts from CSVs |
7:52PM |
1 |
help with simulate AR(1) data |
7:24PM |
1 |
.asp (not really an R question) but related |
7:12PM |
0 |
help on R benchmarks |
7:04PM |
1 |
rollmean and stl |
6:59PM |
1 |
How to simulate heteroscedasticity (correlation) |
6:51PM |
4 |
Function Error |
5:59PM |
2 |
Help with rearranging data |
5:48PM |
2 |
Editor for Mac |
5:16PM |
0 |
2 Courses*** R/Splus Advanced Programming : August 14-15 in Seattle ! by XLSolutions Corp |
4:40PM |
1 |
tklistbox and extracting selection to R |
4:25PM |
2 |
S4 : setGeneric for classical methods |
4:24PM |
1 |
data transformation |
1:57PM |
2 |
Does R have SQL interface in windows? |
1:50PM |
2 |
saving plot both as jpg and pdf |
1:50PM |
1 |
normalised/transformed regressions |
1:47PM |
5 |
How to filter a data frame? |
1:34PM |
0 |
Ignore previous emails |
1:24PM |
4 |
Opening files from R terminal - appologies |
1:18PM |
0 |
loop for multiple regressions |
1:02PM |
3 |
Error in installing packages |
11:58AM |
2 |
randomForest Tutorial |
9:44AM |
2 |
rpart$where and predict.rpart |
8:42AM |
1 |
scatter plot using ggplot |
8:12AM |
1 |
Urgent |
8:00AM |
1 |
determing font type in expression |
7:59AM |
2 |
Table orderd by frequencies |
6:26AM |
1 |
xyplot help |
4:44AM |
1 |
Accessing individual variables from summary of lm |
1:42AM |
1 |
Lattice: How to draw curves from given formulae |
|
Monday July 21 2008 |
Time | Replies | Subject |
11:24PM |
4 |
how to speed up this for loop? |
9:55PM |
1 |
Large number of dummy variables |
9:21PM |
0 |
how to draw multiples curses (for given formulae) in lattice |
9:17PM |
1 |
y-axis number format on plot, barplot etc. |
9:00PM |
0 |
Table of tables? |
8:56PM |
1 |
Using integrate |
7:35PM |
0 |
optimize function help!! |
6:49PM |
3 |
vector help |
6:31PM |
1 |
Control parameter of the optim( ): parscale |
5:39PM |
3 |
Editor fpr Mac OS |
5:02PM |
2 |
Output Nicely formatted tables from R |
3:49PM |
1 |
Parameter names in nls |
3:39PM |
1 |
Mclust - which cluster is each observation in? |
3:22PM |
1 |
dev2bitmap error, 'gs' cannot be found |
3:20PM |
0 |
xyplot: distance between axis and axis-label gets wrong |
3:12PM |
2 |
Creation of png=problems |
3:04PM |
5 |
Coefficients of Logistic Regression from bootstrap - how to get them? |
2:56PM |
1 |
portfolio optimization problem - use R |
2:54PM |
2 |
avoid loop with three-dimensional array |
2:00PM |
1 |
alternate usage of soil.texture (plotrix) |
1:31PM |
1 |
Subsetting data by date |
1:12PM |
1 |
Howto Restart A Function with Try-Error Catch |
12:52PM |
1 |
Cross correlation significance test |
12:13PM |
2 |
Getting plot axes where they should be! |
11:35AM |
2 |
Time Series - Long Memory Estimation |
11:15AM |
0 |
help with integrate function |
10:32AM |
1 |
On creating grouped data set. |
9:11AM |
1 |
fama-macbeth |
9:10AM |
2 |
sampling from a list of values while excluding one |
9:03AM |
0 |
A question on the quandratic programming |
7:52AM |
1 |
CART Analysis |
7:27AM |
0 |
SVM: Graphical representation |
6:09AM |
2 |
CART and CHAID |
2:35AM |
1 |
RODBC - problems using odbcDriverConnect without DSN |
1:03AM |
3 |
Lattice Version of grconvertX or variant on panel.text? |
|
Sunday July 20 2008 |
Time | Replies | Subject |
11:16PM |
0 |
coin package (conditional inference / permutation): parameter teststat |
11:16PM |
1 |
Sum efficiently from large matrix according to re-occuring levels of factor? |
8:33PM |
3 |
enumerate subsets |
7:24PM |
2 |
Erro: cannot allocate vector of size 216.0 Mb |
7:03PM |
0 |
Off topic: SS formulae for 3-way repeated measure anova (for when aov() fails) |
5:27PM |
3 |
asp and ylim |
4:48PM |
2 |
Erro updating HTML package descriptions in packages.html |
4:44PM |
2 |
Conditionally Updating Lattice Plots |
4:34PM |
2 |
fill in area between 2 lines with a color |
4:12PM |
2 |
Indicator Kriging? |
1:42PM |
4 |
Access to values of function arguments |
1:36PM |
0 |
How do I install Joomla! 1.5? |
12:44PM |
4 |
drawing segments through points with pch=1 |
11:32AM |
3 |
Order of columns(variables) in dataframe |
11:19AM |
1 |
Error in edit(name,file,title,editor) |
10:41AM |
2 |
R interprets symbol as q() |
7:45AM |
2 |
problem with read.table |
2:46AM |
1 |
confusion matrix in randomForest |
|
Saturday July 19 2008 |
Time | Replies | Subject |
10:10PM |
2 |
Non-linearly constrained optimisation |
9:21PM |
1 |
estimating volume from xyz points |
8:02PM |
1 |
wroung groupedData despite reading Bates and Pinheiro 3 times |
6:30PM |
1 |
replicate matrix blocks different numbers of times into new matrix |
6:16PM |
1 |
Sweave add code \201 |
4:04PM |
2 |
extracting colnames to label plots in a function |
3:47PM |
1 |
principal factor analysis |
3:14PM |
0 |
fixed effect significance with lmer() vs. t-test |
2:07PM |
1 |
Resshufling algorithm (Thiago Souza) |
1:10PM |
1 |
Discretize continous variables.... |
10:29AM |
2 |
Title for graph with multiple plots |
7:35AM |
3 |
R version 2.7.1 (warnings) |
6:09AM |
3 |
Graphics not working for R in ubuntu |
12:20AM |
2 |
How to solve systems of nonlinear equations in R? |
|
Friday July 18 2008 |
Time | Replies | Subject |
11:13PM |
0 |
Retrieving data from a tcl /tk function |
11:00PM |
1 |
problem with putting text in outer margins (mtext outer=TRUE) |
10:21PM |
2 |
with lapply() how can you retrieve the name of the object |
10:17PM |
0 |
spreading the risk |
9:26PM |
1 |
system time - windows specific problem |
7:51PM |
1 |
Calculating Betweenness - Efficiency problem |
7:11PM |
1 |
Functions similar to step() and all.effects() that work for lme() objects? |
6:42PM |
3 |
using which to identify a range of values |
6:24PM |
3 |
"Spreading risk" in a matrix |
5:52PM |
0 |
copy number estimation through oligo package? |
5:24PM |
0 |
Polynomial Approximation with Exponential Kernel |
4:44PM |
3 |
How to cut data elements included in a text line |
4:37PM |
1 |
par("din") vs dev.size() |
4:08PM |
1 |
cbind help |
3:51PM |
1 |
re ad and check table |
3:46PM |
0 |
dataedit |
3:10PM |
1 |
manipulate a matrix2 |
3:04PM |
2 |
Landscape mode for pdf |
2:03PM |
1 |
creating names for lists |
2:01PM |
0 |
A neural network problem---neuralnet package |
1:37PM |
2 |
source code functions |
12:53PM |
1 |
only "T" becomes logical colum with read.table |
12:37PM |
3 |
Change font-face in title |
12:21PM |
2 |
generate repeats of a vector's elements |
12:11PM |
5 |
Reading SPSS .por files |
11:45AM |
2 |
name returned by lapply |
11:41AM |
0 |
Correction: RStat version 2.7.*1* now available |
10:50AM |
0 |
RStat version 2.7.2 now available |
10:47AM |
1 |
finding "chuncks" of data that have no NA s |
10:15AM |
1 |
t-test for multiple variables |
9:27AM |
0 |
Equation sequencing |
7:36AM |
2 |
column wise paste of data.frames |
7:24AM |
1 |
function "eigen" AND Minitab |
7:18AM |
0 |
Installation of garchOxFit |
1:47AM |
2 |
matrix multiplication question |
12:36AM |
0 |
How to convert/map jacktest results to dataframe or file |
|
Thursday July 17 2008 |
Time | Replies | Subject |
11:09PM |
3 |
Problem with TLC/TK on Ubuntu |
9:31PM |
1 |
combining lists of pairs |
9:01PM |
0 |
Help with data layout - Thanks |
8:57PM |
1 |
smooth.spline |
8:54PM |
2 |
nested calls, variable scope |
8:42PM |
4 |
Matching Up Values |
6:54PM |
1 |
ubuntu and rgl package vs suse ?? static plots |
5:47PM |
3 |
Display variables when running a script |
5:40PM |
4 |
REvolution computing |
4:22PM |
0 |
Can mvtnorm calculate a sequence of probabilities? |
4:08PM |
0 |
keeping seperate row.names |
3:57PM |
3 |
Hiding information about functions in newly developed packages |
3:50PM |
4 |
help with data layout |
3:32PM |
1 |
Newbie's question about lm |
3:29PM |
2 |
Sampling distribution (PDF & CDF) of correlation |
2:25PM |
3 |
Colours in R |
2:14PM |
3 |
Graph |
2:06PM |
1 |
Comparing differences in AUC from 2 different models |
1:58PM |
1 |
errors using step function |
1:44PM |
0 |
Re : Re : float and double precision with C code |
1:25PM |
0 |
Re : float and double precision with C code |
12:47PM |
1 |
float and double precision with C code |
12:47PM |
0 |
how to split the string |
12:26PM |
1 |
histogram plot default |
12:26PM |
2 |
spliting a string |
11:37AM |
2 |
fastICA |
9:49AM |
0 |
model.tables standard errors |
9:47AM |
5 |
calculate differences - strange outcome |
9:33AM |
0 |
How to compute loglikelihood of Lognormal distribution |
9:13AM |
3 |
Histogram with two colors depending on condition |
5:41AM |
2 |
Fw: how i can install Rgraphviz in R2.7.1 |
2:27AM |
2 |
Location of HTML help files |
1:11AM |
0 |
create a function from a model |
12:17AM |
1 |
plot(linear model) without lines |
|
Wednesday July 16 2008 |
Time | Replies | Subject |
11:45PM |
2 |
Stratified random sample |
10:26PM |
3 |
Function to verify existence of an R object |
9:27PM |
2 |
spectral decomposition for near-singular pd matrices |
8:17PM |
2 |
Labelling curves on graphs |
8:14PM |
1 |
RSQLite maximum table size |
7:09PM |
1 |
help with bivariate density plot question |
6:51PM |
2 |
gstat problem with lidar data |
4:47PM |
0 |
Help with rpart.predict? |
4:43PM |
0 |
Confidence bands for model estimates using ns() spline basis |
4:08PM |
4 |
Likelihood ratio test between glm and glmer fits |
4:06PM |
1 |
Problem with mpi.close.Rslaves() |
3:57PM |
0 |
Forecasting enrollments with fuzzy time series |
3:56PM |
1 |
Help regarding arules package |
3:51PM |
1 |
Output design question |
1:10PM |
1 |
NAMESPACE vs internal.Rd |
12:29PM |
1 |
R-source code of a function |
11:41AM |
1 |
date to decimal date conversion |
10:48AM |
2 |
barchart with bars attached to y=0-line |
8:21AM |
2 |
Group level frequencies |
7:28AM |
2 |
Howto view function's source code of an installed package |
5:40AM |
0 |
Simulate data with binary outcome |
5:32AM |
1 |
negative P-values with shapiro.test |
4:03AM |
0 |
Off-topic - Data needed |
3:55AM |
2 |
How to extract component number of RMSEP in RMSEP plot |
1:48AM |
1 |
Help Updating and Installing R Packages |
12:40AM |
1 |
R logo |
|
Tuesday July 15 2008 |
Time | Replies | Subject |
11:58PM |
0 |
implementation of Prentice method in cch() |
11:51PM |
2 |
New Zealand Maps |
9:51PM |
1 |
What package to use to create a GUI |
9:35PM |
2 |
Row Sum, exclude positive values |
9:00PM |
3 |
Melt (reshape) question |
8:37PM |
1 |
Filtering output |
8:20PM |
2 |
sem & testing multiple hypotheses with BIC |
7:51PM |
0 |
generalized spatial autoregressive lag model |
7:50PM |
2 |
POSIXct extract time |
7:34PM |
0 |
how to get confidential interval for classification accuracy using 10-fold validation in svm package |
7:21PM |
1 |
code reduction (if anyone feels like it) |
6:53PM |
0 |
INSEED statistics workshop on Statistical Models and Practices in Epidemiology (using R) |
6:51PM |
0 |
INSEED Statistics Workshop on Bayesian statistics using OpenBUGS and R |
5:52PM |
0 |
Help with maptools sunriset() |
5:12PM |
1 |
aov error with large data set |
5:11PM |
4 |
Iterations |
4:52PM |
1 |
sunrise sunset calculations |
4:33PM |
0 |
Calculating Stream Metabolism |
3:27PM |
5 |
counting number of "G" in "TCGGGGGACAATCGGTAACCCGTCT" |
3:09PM |
2 |
extracting elements from print object of Manova() |
2:19PM |
0 |
DOE for logistic models |
2:08PM |
2 |
Problem installing R on openSUSE 10.3 |
1:42PM |
3 |
Font quality in base graphics |
1:07PM |
1 |
manipulating (extracting) data from distance matrices |
1:00PM |
0 |
creating axis of the plot before data are plotted -- solved |
12:40PM |
3 |
playwith package crashes on Mac |
12:16PM |
4 |
Mapping data onto score |
12:16PM |
1 |
Mapping data onto 1-10 score |
12:02PM |
2 |
Regression problem |
11:41AM |
0 |
linear and non linear regression in 3D ! |
11:05AM |
2 |
Layers in graphs |
10:59AM |
1 |
tryCatch - return from function to main script |
9:41AM |
0 |
Odd behavior of remove command |
8:33AM |
1 |
Supressing printing from a function: ecdf |
7:56AM |
1 |
Proxy again, this time on a Mac |
6:57AM |
2 |
enscript states file for R scripts? |
4:34AM |
2 |
meaning of tests presented in anova(ols(...)) {Design package} |
4:33AM |
0 |
[Ask]Robust Buckley-James like estimator |
1:36AM |
0 |
r^2 for SSasymp? |
|
Monday July 14 2008 |
Time | Replies | Subject |
11:07PM |
2 |
long data frame selection error |
10:57PM |
2 |
position of a specific character |
10:24PM |
2 |
modeling binary response variables |
10:16PM |
2 |
question about a small "for" loop |
10:10PM |
0 |
[Fwd: Re: Insurance review statistical methods] |
9:51PM |
0 |
rgl.snapshot on linux produces colored lines only |
9:47PM |
2 |
Insurance review statistical methods |
9:44PM |
0 |
Extract and plot array from data |
9:40PM |
2 |
Convert data set to data frame |
9:29PM |
3 |
Data Manipulations and SQL |
9:26PM |
1 |
Function to create variables with prefix |
8:47PM |
3 |
statistics question about a statement in julian faraway's "extending the linear model with R" text |
6:50PM |
1 |
Analysis of poorly replicated array data |
6:34PM |
2 |
.First and .Rprofile won't run on startup |
6:09PM |
2 |
Backslash in sub pattern? |
5:56PM |
1 |
R Commander question |
4:49PM |
1 |
dll problem |
3:49PM |
1 |
Help with an error message |
3:46PM |
0 |
.Last() and namespace |
3:21PM |
1 |
creating axis of the plot before data are plotted |
3:03PM |
1 |
macros in R |
3:00PM |
5 |
A question about using function plot |
2:39PM |
0 |
swap_tail macro in pnorm.c |
2:39PM |
1 |
applying complex functions by groups |
2:23PM |
0 |
ampersand char in the path causing error message when running rscript.bat |
1:38PM |
0 |
Can't compile in HPUX 11.31 on IA64 |
12:37PM |
2 |
aggregate months to years |
11:50AM |
1 |
options() question for displaying numbers in the GUI |
11:18AM |
1 |
How to load stats4 package |
10:41AM |
1 |
Tissue specific genes by ANOVA? |
10:20AM |
2 |
how to correlate nominal variables? |
10:18AM |
0 |
"Reasonable doubt" - was "Re: shapiro wilk normality test" |
10:16AM |
0 |
Frequency-Table on Group Level - Multi Level Analysis |
10:07AM |
0 |
nlme, lme( ) convergence and selection of effects |
9:04AM |
1 |
eval.wih.vis |
8:45AM |
1 |
rm(l*) |
8:33AM |
3 |
Loop problem |
7:50AM |
0 |
Question regarding lmer vs glmmPQL vs glmm.admb model on a negative binomial distributed dependent variable |
7:03AM |
1 |
How to extract folowing data? |
6:04AM |
1 |
source code for R-dev packages |
5:41AM |
0 |
Using Internals via their compiled sources |
1:57AM |
1 |
Off topic: Tcl/Tk outside R. |
1:03AM |
1 |
Computing row means for sets of 2 columns |
12:34AM |
0 |
Moran's I- Ordinal Logistic Regression |
12:24AM |
0 |
Moran's I test- Ordinal Logistic Regression Model |
|
Sunday July 13 2008 |
Time | Replies | Subject |
10:31PM |
2 |
any way to set defaults for par? |
9:40PM |
1 |
stem and leaf plot: how to edit the stem-values |
8:05PM |
1 |
(no subject) |
7:19PM |
0 |
rm anova |
4:47PM |
3 |
initialize a factor vector |
|
Saturday July 12 2008 |
Time | Replies | Subject |
10:09PM |
0 |
A (not so) Short Introduction to S4 |
8:23PM |
1 |
How to build a package which loads Rgraphviz (if installed)... |
7:50PM |
1 |
Installing RWinEdt |
7:46PM |
2 |
Excel Trend Function |
7:22PM |
0 |
R-outlet: Journal of Statistical Software |
5:28PM |
0 |
Reading Multi-value data fields for descriptive analysis (resend) |
4:37PM |
1 |
Reading Multi-value data fields for descriptive analysis |
3:30PM |
5 |
shapiro wilk normality test |
3:23PM |
4 |
problem |
2:12PM |
2 |
Quick plotmath question |
1:23PM |
0 |
Visualization of multiple alignments |
11:23AM |
1 |
a warning message from lmer |
7:56AM |
1 |
Error of exp() in a dll from Fortran |
7:48AM |
1 |
Help with arima.sim |
7:32AM |
1 |
Assoociative array? |
6:57AM |
1 |
Another packaging question |
3:32AM |
3 |
Another failed attempt to install an R package in Ubuntu |
|
Friday July 11 2008 |
Time | Replies | Subject |
10:47PM |
1 |
data summarization etc... |
10:44PM |
3 |
data summerization etc... |
8:38PM |
1 |
Plot multiple datasets on a VCD ternary graph |
7:57PM |
3 |
List help |
6:25PM |
2 |
plotting granular data |
5:57PM |
1 |
Difficultes with grep |
5:06PM |
1 |
While loop |
4:48PM |
2 |
Help with error in "if then" statement |
4:42PM |
0 |
GroupedData for three way randomized block. LME |
4:25PM |
1 |
reading in a subset of a large data set |
3:51PM |
1 |
Comparing complex numbers |
3:50PM |
1 |
More compact form of lm object that can be used for prediction? |
3:41PM |
1 |
mpirun question with Rmpi |
3:30PM |
1 |
TeachingDemos question: my.symbols() alignment problems in complicated layout |
2:53PM |
1 |
Subsetting an array by a vector of dimensions |
2:53PM |
1 |
Meaning of Positive LogLikelihood |
1:56PM |
0 |
modified ks.test? |
1:04PM |
2 |
network |
12:37PM |
0 |
Funnel plots |
10:35AM |
0 |
Funnel plots in r |
9:43AM |
0 |
how to test this multivariate normal distribution? |
9:42AM |
3 |
Start preferred RGui |
8:22AM |
1 |
Any R package about COALESCENT THEORY/GENEOLOGICAL TREES?? |
5:13AM |
1 |
How to output 0.405852702657738 as 0.405853 ? |
1:46AM |
3 |
number of effective tests |
12:47AM |
2 |
Problems with Package Installation. |
|
Thursday July 10 2008 |
Time | Replies | Subject |
11:00PM |
2 |
princomp loading help |
10:07PM |
1 |
R bug in the update of nlme? |
10:03PM |
1 |
odfWeave problem in 7.1? |
8:54PM |
0 |
predict.garch problem |
8:43PM |
1 |
Interpretation of EXACT Statistical Test in finding the probability as Std. Deviations (SumP) |
8:28PM |
1 |
layout is to xyplot as ??? is to qplot |
8:07PM |
5 |
rounding |
6:51PM |
1 |
Ellipsis arguments for plot.formula |
6:39PM |
1 |
search with help.start |
6:27PM |
1 |
compiling pnmath on an intel processor running mac OS 10.5 |
6:21PM |
3 |
Sorting a matrix |
5:11PM |
0 |
Rmpi unkown input format error |
4:50PM |
1 |
embarrassingly parallel problem - simple loop solution |
4:49PM |
3 |
What's the T-Value in fisher.test |
4:21PM |
0 |
by() function doesn't work inside another function |
3:45PM |
1 |
S4 class questions |
3:28PM |
0 |
ppls: version 1.02 including a new data set |
3:21PM |
0 |
ace error because of missings? |
3:13PM |
0 |
How to check how much memory has been used or reserved ? |
2:41PM |
2 |
false discovery rate ! |
2:35PM |
2 |
xYplot customizing y-axis scaling |
2:01PM |
1 |
Non-normal data issues in PhD software engineering experiment |
12:41PM |
2 |
Position in a vector of the last value > n |
11:56AM |
4 |
Turn any vector |
11:55AM |
0 |
Bootstrap in betareg() |
10:44AM |
1 |
quantile regression estimation results |
10:22AM |
3 |
Sorting / editing a table |
9:44AM |
1 |
problems with rq.fit.sfn |
8:54AM |
1 |
Operator overloading |
6:15AM |
4 |
Interpolation of data |
6:10AM |
3 |
specifying data |
6:04AM |
2 |
Finding Values that Occur Most Often in a Vector |
4:47AM |
2 |
Lattice: merged strips? |
4:04AM |
1 |
“Check” problem |
1:15AM |
1 |
Basic help needed |
12:50AM |
2 |
Help on Installing Matrix Package in Linux (Fedora) |
|
Wednesday July 9 2008 |
Time | Replies | Subject |
11:07PM |
0 |
Help navigating documentation for descriptive statistics |
10:33PM |
1 |
use variable value as vector name |
10:02PM |
3 |
Grid building in R |
9:38PM |
1 |
zoo and cex |
8:26PM |
1 |
matplot help |
8:24PM |
1 |
read.table problem |
7:17PM |
3 |
randomly select duplicated entries |
7:16PM |
2 |
Read.table - Less rows than original data |
6:57PM |
1 |
Sweave figure |
6:57PM |
2 |
shifting data in matrix by n rows |
6:51PM |
0 |
ftp directory |
6:45PM |
0 |
garchFit problem |
6:31PM |
0 |
"Rotated Lat-Lon" projection in mapproj |
6:26PM |
0 |
question on FARIMA innovations |
5:49PM |
1 |
outlining symbol in legend with blackline |
5:30PM |
3 |
rbinom for a matrix |
5:01PM |
1 |
Question regarding lu in package Matrix |
4:50PM |
2 |
rollmean() |
4:42PM |
2 |
Port package |
4:15PM |
2 |
build matrix with the content of one column of a data frame in function of two factors |
3:56PM |
0 |
rJava crashes jvm |
3:49PM |
2 |
gsub and "\" |
3:28PM |
4 |
Find the closest value in a list or matrix |
3:26PM |
1 |
lapply |
3:15PM |
5 |
Summary Stats (not summary(x)) |
12:34PM |
1 |
netCDF to TIFF |
11:00AM |
1 |
childNames for xaxis grob (grid package) |
10:59AM |
0 |
RJDBC and OracleDriver: unable to connect |
10:36AM |
1 |
plot gam "main effect functions" in one graph |
10:20AM |
1 |
version problems of rkward in ubuntu hardy repository |
10:09AM |
4 |
Strptime/ date time classes |
9:58AM |
0 |
problems using mice() |
9:55AM |
0 |
Question concerning Furness iteration & subprogram/modules |
9:40AM |
7 |
recursively divide a value to get a sequence |
9:34AM |
1 |
"non-sample" standard-deviation |
9:33AM |
2 |
Parsing |
9:21AM |
3 |
Expression in axis |
9:13AM |
2 |
replacing value in column of data frame |
8:29AM |
1 |
building experimental paradigm with R as "Brainard/Pelli Psych Toolbox" |
7:40AM |
1 |
Help with installing add-on packages |
5:21AM |
0 |
Installing R package but got Fortran 90 error |
4:06AM |
1 |
Loglikelihood for x factorial? |
2:58AM |
2 |
sorting a data frame by rownames |
2:52AM |
2 |
cex.axis for the x axis |
|
Tuesday July 8 2008 |
Time | Replies | Subject |
8:56PM |
1 |
aggregate() function and na.rm = TRUE |
8:14PM |
1 |
calculation of entropy in R??? |
7:55PM |
0 |
Fwd: Re: extracting index list when using tapply() |
6:33PM |
2 |
nls and "plinear" algorithm |
6:31PM |
6 |
Automatic placement of Legends |
6:23PM |
3 |
extracting index list when using tapply() |
5:43PM |
1 |
making zoo objects with zoo without format argument? |
5:39PM |
1 |
Plot |
5:23PM |
2 |
How I count the all possible samples?? |
4:58PM |
1 |
R crash with ATLAS precompiled Rblas.dll on Windows XP Core2 Duo |
4:57PM |
0 |
Gage R & R |
4:42PM |
1 |
fisher.test |
3:58PM |
0 |
How to draw dot plots for 2 vectors seperately |
3:36PM |
0 |
simulate data for lme |
2:53PM |
1 |
R package |
2:25PM |
2 |
time series by calendar week |
1:36PM |
0 |
Specific question on LDheatmap |
1:32PM |
1 |
about EM algorithm |
1:28PM |
0 |
help for xvalid with external data |
1:18PM |
6 |
Question: Beginner stuck in a R cycle |
12:53PM |
3 |
Can I do regression by steps? |
12:45PM |
0 |
workspace platform potabillity |
11:57AM |
1 |
Help with eigenvectors |
11:43AM |
0 |
Multiple Plots and y Axis Labels |
11:22AM |
4 |
Histogram with colors according to factor |
11:11AM |
4 |
Manipulate Data (with regular expressions) |
11:07AM |
0 |
Change legend in the 'hydrogeo' package |
10:36AM |
0 |
forecast & xreg |
10:28AM |
2 |
Constrained optimization |
9:40AM |
2 |
attributing values to dataframe positions following eval |
8:36AM |
1 |
package segmented problem |
8:14AM |
1 |
shading an area in a edf |
8:11AM |
0 |
what does this warning mean ? |
8:00AM |
2 |
How to change labels in a histogram |
7:38AM |
2 |
Change in behaviour of sd() |
5:59AM |
4 |
Can R do this ? |
5:58AM |
8 |
Sum(Random Numbers)=100 |
4:41AM |
1 |
odd dnorm behaviour (?) |
3:59AM |
2 |
list genes w/n a genomic fragment |
|
Monday July 7 2008 |
Time | Replies | Subject |
11:56PM |
5 |
question on lm or glm matrix of coeficients X test data terms |
9:07PM |
5 |
Basic Vector and Matrix Operations |
7:19PM |
3 |
subset() multiple arguments |
6:42PM |
1 |
Interest in a Use R Group in San Francisco area? |
6:03PM |
2 |
A shorter version of ".Last.value"? |
5:51PM |
2 |
Colour clusters in a 2d plot |
4:06PM |
2 |
Drawing a colour wheel - bug in hcl? |
3:18PM |
2 |
Running "all possible subsets" of a GLM (binomial) model |
2:45PM |
1 |
Plot depends on conditions |
1:38PM |
3 |
A quick question about lm() |
12:29PM |
2 |
Sorting a list |
9:44AM |
0 |
Howto Initialize Parameter of Gamma Mixture Densities for EM |
9:19AM |
2 |
indicating significant differences in boxplots |
9:17AM |
1 |
How can I optimize this piece of code ? |
9:15AM |
2 |
one-site competition data // curve fitting |
8:49AM |
1 |
Change language in Rcmdr |
7:48AM |
1 |
GLM, LMER, GEE interpretation |
3:24AM |
4 |
Plot Mixtures of Synthetically Generated Gamma Distributions |
2:48AM |
0 |
Functional Data Analysis, fda_1.2.4 |
1:39AM |
5 |
How can i do an automatic upgrade of R 2.5.1 to R 2.7.1 |
|
Sunday July 6 2008 |
Time | Replies | Subject |
11:50PM |
4 |
Method for checking automatically which distribtions fits a data |
11:36PM |
1 |
Exception Handling |
11:35PM |
0 |
color with tcl/tk? |
10:34PM |
4 |
Numbers as Points in Graphs |
9:41PM |
2 |
Issue with postscript figures using WinAnsi encoding |
9:17PM |
2 |
Regular expressions: bug or misunderstanding? |
8:07PM |
0 |
Benchmarking R and R Workloads |
7:36PM |
1 |
ts.plot |
7:19PM |
5 |
Error in defining function |
6:07PM |
1 |
What is my replication unit? Lmer for binary longitudinal data with blocks and two treaments. |
4:01PM |
2 |
Hi~problem with the two sample test: ks2Test in the package of fbasics |
3:39PM |
3 |
Lots of huge matrices, for-loops, speed |
2:37PM |
1 |
Windows Only: winMenuAdd() problem |
2:24PM |
1 |
Backgrounds in Multiple Plots made with "fig" |
1:32PM |
1 |
Interpreting messages when building packages |
11:52AM |
1 |
lattice smooth problem? |
8:59AM |
2 |
looking for alternative of 'if-else' |
6:13AM |
2 |
lattice question |
5:22AM |
1 |
Different Autocorrelation using R and other softwares |
1:44AM |
2 |
Error: cannot use PQL when using lmer |
12:51AM |
1 |
interpreting mixed model anova results |
|
Saturday July 5 2008 |
Time | Replies | Subject |
10:14PM |
0 |
Problem solved: extracting values from a "by" function |
9:59PM |
0 |
extracting values from a "by" function |
7:25PM |
1 |
Random Forest %var(y) |
6:55PM |
1 |
SciViews GUI |
4:13PM |
5 |
help about random generation of a Normal distribution of several variables |
8:17AM |
2 |
Bland-Altman method to measure agreement with repeated measures |
8:00AM |
0 |
lattice smooth |
7:26AM |
3 |
trying to superimpose a line plot onto a histogram |
4:14AM |
2 |
p-value for Nonmetric Multidimentional Scaling? |
|
Friday July 4 2008 |
Time | Replies | Subject |
11:23PM |
1 |
synthax for R CMD INSTALL |
10:36PM |
2 |
set type of SS in anova() |
8:05PM |
1 |
logistic regreesion and score test |
6:42PM |
0 |
RES: initialize a matrix |
3:50PM |
2 |
create a zero matrix & fill |
3:18PM |
1 |
Calling and running a compiled program inside R |
2:38PM |
4 |
Re ad in a file - produce independent vectors |
2:22PM |
1 |
initialize a matrix |
1:57PM |
1 |
update search path for attached data |
1:40PM |
1 |
Test for multiple comparisons: Nonlinear model, autocorrelation? |
1:24PM |
1 |
Repeated measures lme or anova |
12:42PM |
0 |
test for difference in variance |
12:04PM |
1 |
stop without error message |
12:02PM |
0 |
passing arguments to a R script |
11:59AM |
1 |
Hmisc latex: table column width |
7:23AM |
1 |
Problem in installing Biobase |
7:08AM |
1 |
kriging problem(?) |
6:29AM |
3 |
problem with NA and if |
3:54AM |
1 |
by or tapply? |
|
Thursday July 3 2008 |
Time | Replies | Subject |
10:49PM |
1 |
Ternaryplot function |
10:48PM |
1 |
'as.Date' conversion of classes POSIX*t (problem/feature)? |
10:04PM |
3 |
apply with a division |
9:25PM |
1 |
subset function within a function |
9:09PM |
2 |
First attempt to use R |
8:46PM |
2 |
L1 nonlinear approximation |
8:43PM |
1 |
lines() warning message |
8:37PM |
1 |
Installation of packages via GUI, Mac OS X |
8:14PM |
1 |
Exporting a Graph that has lines() |
7:36PM |
0 |
FW: For loop |
6:57PM |
3 |
Recoding a variable |
6:19PM |
3 |
Re membering the last time an event occurred within a dataframe |
5:59PM |
2 |
Relative Mortality Risk second part |
5:54PM |
1 |
R-help Digest, Vol 65, Issue 4 |
5:33PM |
0 |
Random effects and lme4 |
5:13PM |
0 |
Biostatistician Positions at Vanderbilt University |
3:52PM |
0 |
Reproducibility and GUIs |
2:40PM |
1 |
read.table, NA assignment, and sep |
2:04PM |
1 |
cross-validation in rpart |
1:38PM |
1 |
ggplot2: scaling and tick mark of x-axis |
1:35PM |
2 |
How to emulate perl style of reading files ? |
1:28PM |
1 |
combining time series [was: (no subject)] |
12:41PM |
1 |
*** significance with xtable |
12:14PM |
0 |
loop calculation |
11:41AM |
1 |
Data size |
9:25AM |
1 |
Problem in applying conditional looping |
9:15AM |
2 |
PCA on image data |
9:12AM |
2 |
as.Date() clarification |
8:02AM |
2 |
Matrix set value problem |
8:01AM |
1 |
ggplot2 legend for vertical lines |
7:52AM |
2 |
latex styling for R regression outputs |
7:38AM |
0 |
(no subject) |
7:38AM |
0 |
post hoc comparisons on NLME for longitudinal data |
7:37AM |
1 |
RODBC Access limit? |
6:41AM |
1 |
randomForest.error: length of response must be the same as predictors |
3:35AM |
1 |
Otpmial initial centroid in kmeans |
3:21AM |
1 |
Processing 10^8 rows and 1^3 columns |
2:43AM |
1 |
lm() question |
1:40AM |
3 |
problem with lm and predict - no predictions made |
1:33AM |
1 |
how to capture matching words in a string ? |
1:25AM |
2 |
How do I paste double quotes arround a character string? |
12:47AM |
2 |
Plotting Prediction Surface with persp() |
12:41AM |
2 |
what can we do when R gives no response |
12:17AM |
1 |
Migrating from S-Plus to R - Exporting Tables |
|
Wednesday July 2 2008 |
Time | Replies | Subject |
11:24PM |
0 |
neural networks |
9:29PM |
1 |
Removing or overwriting an XML node |
9:17PM |
1 |
set values in data.frame to NA conditional on another data.frame |
7:56PM |
1 |
exporting ftable |
7:21PM |
1 |
graph woes |
7:20PM |
0 |
Goodness of fit test |
7:10PM |
2 |
Accessing a field in a data fram |
6:55PM |
1 |
flow map lines between point pairs (latitude/longitude) |
6:55PM |
2 |
Reading CSV file with unequal record length |
6:49PM |
2 |
help appreciated to make a plot |
6:02PM |
1 |
heatmap |
5:58PM |
1 |
Problem with strucchange package |
5:22PM |
0 |
question on dispersion parameter |
4:55PM |
0 |
error on predict |
4:30PM |
5 |
multiplication question |
4:23PM |
1 |
auto.key in xyplot in conjunction with panel.text |
4:22PM |
1 |
Sunset in Dortmund |
4:13PM |
1 |
Extracting regression coef. and p-values in JRClient |
4:04PM |
2 |
get formatted regression output |
3:58PM |
1 |
Hmisc latex function with longtable option |
3:37PM |
1 |
help on list comparison |
3:21PM |
0 |
log plots woes |
2:54PM |
1 |
Multiple time series plots |
2:52PM |
1 |
Tobit Estimation with Panel Data |
2:39PM |
1 |
Insert text in data.frame |
2:28PM |
1 |
Usage of rJava (.jcall) with Weka functions, any example? |
2:24PM |
2 |
Problem reading from a data frame |
1:44PM |
1 |
randomForest training error |
1:31PM |
3 |
variable as part of file name |
1:30PM |
1 |
survival package test stats |
1:25PM |
1 |
Zoo plotting behavior |
12:42PM |
0 |
Question about GCL function |
12:29PM |
1 |
FW: RES: bug in axis.Date? was (Re: newbie needs help plottingtimeseries) |
12:24PM |
1 |
Can't install package Matrix on solaris. |
10:53AM |
1 |
how do I read only specific columns using read.csv or other read function |
10:28AM |
2 |
Correlation structures in gls with repeated measurements |
10:05AM |
0 |
Sweave / Latex per-chapter output |
9:52AM |
1 |
conversion of data for use within barchart |
9:49AM |
0 |
Combining playwith with par(mfrow... ) i.e., multiple plots. |
9:41AM |
2 |
position legend below x-axis title |
8:41AM |
2 |
Optimal lag selection in Granger Causality tests |
3:20AM |
0 |
Survival Analysis questions |
2:43AM |
0 |
forget my previous question |
2:41AM |
1 |
is there an equivalent of prop.table but for counts |
2:10AM |
1 |
Install Packages in Windows Vista |
|
Tuesday July 1 2008 |
Time | Replies | Subject |
11:49PM |
4 |
passing a variable at the command line |
11:16PM |
1 |
adding a package in Windows |
10:38PM |
2 |
Area Under a Curve |
10:20PM |
2 |
Graph Order in xyplot |
9:25PM |
2 |
plot.zoo labels |
7:17PM |
3 |
Change name of a specific column of a data frame |
7:15PM |
3 |
plot window |
7:11PM |
2 |
Problem with loading library-ks |
7:03PM |
2 |
problem with mpiexec and Rmpi |
6:28PM |
2 |
Fitting a curve to data |
6:15PM |
5 |
WIERD: Basic computing in R |
5:49PM |
3 |
Ignore blank columns when reading a row from a table |
5:12PM |
1 |
Simulate from a GAM model |
5:12PM |
1 |
Orthogonal polynomials and poly |
4:54PM |
2 |
Prediction with Bayesian Network? |
4:11PM |
2 |
ignore warning messages? |
3:49PM |
2 |
how to automatically maximize the graph window (under XP) ? |
3:21PM |
2 |
"Invalid object" error in boxplot |
3:14PM |
1 |
Plotting Bi-Gamma Distribution |
3:03PM |
1 |
select.list() cannot be used non-interactively |
2:54PM |
0 |
Query on packages for Emerging Patterns |
1:50PM |
4 |
Find classes of each column of data.frame() |
1:38PM |
5 |
A regression problem using dummy variables |
12:55PM |
0 |
cohort sampling |
12:46PM |
5 |
trivial list question |
12:40PM |
2 |
if one of 4 conditions is not satisfied |
10:20AM |
3 |
dev.off() inside a function & other glitches |
9:58AM |
3 |
reshape matrices |
9:17AM |
2 |
Set default value |
8:57AM |
1 |
Help on Analysis of covariance |
8:46AM |
1 |
Installing R into home directory? |
8:03AM |
2 |
Are centre coordinates or upper left corners used of x, y for SpatialPixels? |
7:40AM |
1 |
extracting elements from a list in vectorized form |
3:44AM |
1 |
Messge ``no visible binding''. |
2:08AM |
2 |
PCA : Error in eigen(cv, |
12:54AM |
1 |
Help in using PCR |