R help - Jul 2008

Thursday July 31 2008
TimeRepliesSubject
11:28PM 1 clustering and data-mining...
10:41PM 0 multiple comparison
9:29PM 2 Help with hazard plots
9:22PM 1 anisotropy in vgm model. HELP!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
9:21PM 2 dput vs unclass to see what a factor really is composed of
9:19PM 2 allocMatrix limits
9:18PM 2 sort rows of matrix by rows of another matrix
8:40PM 3 cutting out numbers from vectors
8:30PM 1 strip names lattice graphics
8:20PM 1 Randomly drawing observations from factors.
8:07PM 4 instal tar.gz package on windows
8:05PM 0 vertical bpplot
7:54PM 1 bwplot with Date object
7:51PM 1 'system' command through Rserve
7:36PM 1 rollapply() to portions of a matrix
6:47PM 2 How to output R image to a file?
6:17PM 0 anisotrophy in fit.variogram problem
5:24PM 5 Random number generation
5:11PM 0 hwriter - Writing R objects in HTML format
4:08PM 0 Sperman Correlation with rcorr (Hmisc)
4:05PM 3 Code to calculate internal rate of return
1:53PM 0 Identifying Points That Belongs to Components of Mixture Models
11:31AM 1 nls weights warning message
11:11AM 4 Identifying common prefixes from a vector of words, and delete those prefixes
10:20AM 0 OT:Selling Data Mining Cloud-A Concept
9:31AM 0 random effects mixed model, different regressors
9:29AM 1 combinations with replications
9:10AM 1 add string
4:46AM 2 stats question
4:38AM 1 High resolution graphics from R Windows Vista
4:17AM 0 Generic plot function for GLM objects
4:12AM 1 Rearranging Data
4:02AM 1 multiple separators in scan() functions
3:37AM 1 predict rpart: new data has new level
2:40AM 2 S 3 generic method consistency warning please help
2:36AM 1 colnames from read.table
1:29AM 0 High resolution graphics from Windows Vista
12:53AM 0 curva PI
12:29AM 0 Is conditional evaluation of R code chunks possible in Sweave ?
 
Wednesday July 30 2008
TimeRepliesSubject
11:19PM 1 dotFirst option
10:43PM 1 question about krige code in R
10:14PM 1 barplot for a categorial variable
9:48PM 2 Sampling two exponentials
7:52PM 1 Converting to subscripts and superscripts
7:04PM 1 Setting fixed size for segement plot using stars() (axes size vs print size)
6:27PM 2 john chambers R book
6:27PM 2 System exit codes
6:18PM 3 Random subset
6:12PM 5 History pruning
5:54PM 1 setting editor environment variable EDITOR either when configuring R for installation or in .Rprofile
5:22PM 1 Variable name in a String
5:04PM 1 best quad core configuration?
4:56PM 1 Hello,
4:47PM 1 bug in 'margins' behavior in reshape - cast
4:45PM 0 OT: Data mining on demand .Using cloud computers.
4:30PM 0 FOURIER TRANSFORM HELP
4:09PM 0 Axes in perspective plot - persp()
3:18PM 0 Percent Change After Each Interval
2:56PM 1 Rprintf will not build in my C++ compiler
1:54PM 1 model mix problem. FALSE CONVERGENCE
1:48PM 1 odds ratios in multiway tables (stratified)
1:41PM 1 Unexpected line type in lattice plot key on pdf device
1:39PM 2 R -Legality Question about R's Open Source GNU GPL License
1:11PM 1 adding lines to multiple plot
12:36PM 0 Connecting R to PostgreSQL on Windows.
12:18PM 0 "dens" function
11:59AM 1 Re creating Procrustes Plot in Lattice
11:14AM 2 FFT - (STATS) - is this correct?
11:03AM 1 Mixed effects model where nested factor is not the repeated across treatments lme???
10:41AM 0 adding lines to multiple plots
10:37AM 0 png() does not generate a 24 bit PNG file
10:34AM 0 glm error: factor levels
9:54AM 2 Bizarre - R crashes on merge
9:50AM 1 function to transform response of a formula
9:38AM 1 read XML
9:31AM 0 R GUI help
9:24AM 2 problem with read.table()
8:53AM 6 Need help
8:44AM 1 need some help
8:28AM 2 Eclipse/Statet: How to set breakpoints
8:21AM 0 Successfully connected GNU R to PostgreSQL on windows XP.
7:49AM 1 problem with nested loops
7:44AM 1 ~ . help
4:58AM 2 Repeated Measure ANOVA-Old question
12:32AM 2 how to get the position of a vector-value
 
Tuesday July 29 2008
TimeRepliesSubject
10:41PM 1 What's the best way to operate R from within Excel?
10:20PM 1 Is there a better way to check if an element of a list exists than using match on names?
10:15PM 1 rolling regression between adjacent columns
10:04PM 3 placing a text in the corner of a plot
9:58PM 1 correlation between matrices - both with some NAs
7:40PM 0 optimize simultaneously two binomials inequalities using nlm
7:23PM 2 R command history -- can it be like Matlab's?
6:12PM 3 finding a faster way to do an iterative computation
6:12PM 0 Flexible semivariogram in R (HELP)
5:45PM 1 List names help
5:30PM 0 Major Cloud Computing Testbed Announced at University of Illinois
4:56PM 2 accessing list elements
4:55PM 3 try question
4:38PM 4 Graphics function question
4:36PM 1 ls() and memory question
4:28PM 3 table questions
4:27PM 0 Question regarding statisticians
4:12PM 1 more environment questions
4:11PM 0 Bootstraping GAMs for confidence intervales calculation
4:00PM 1 tensor product of equi-spaced B-splines in the unit square
3:37PM 1 Removing script file
3:36PM 0 subscript out of bounds help
3:28PM 2 biplot_group_colours_and_point_symbols
3:26PM 0 subscript out of bounds error.
2:51PM 2 Most often pairs of chars across grouping variable
2:09PM 2 About clustering techniques
2:03PM 1 Howto Draw Bimodal Gamma Curve with User Supplied Parameters
1:01PM 1 combining zoo series with an overlapping index?
11:55AM 2 'for' loop, two variables
11:42AM 1 optim fails when using arima
11:38AM 0 stringdot ?
11:34AM 2 Panel of pie charts
11:14AM 0 mac install no font found problem in quartz display
10:32AM 0 max
10:10AM 2 FW: Installing BRugs
9:51AM 1 Bug in sd() and var() in handling vectors of NA (R version 2.7.1)?
9:24AM 1 keywords
8:49AM 1 Problem reading a particular file with read.spss()
7:37AM 1 How to set the parameters in Trellis Graphics (by Lattice package)
5:00AM 1 list
4:23AM 2 Is there anyway to clip the bottom of a barplot?
4:14AM 2 Help interpreting density().
2:04AM 1 environment question
12:58AM 0 "wave model" semivariogram
 
Monday July 28 2008
TimeRepliesSubject
10:42PM 1 Is there a way to avoid loading dependendent packages?
10:41PM 2 Rf_error crashes entire program.
8:24PM 1 loop does not work
7:36PM 1 How to unsubscribe?
7:15PM 3 Is there way to multiple plots on gap.plot?
6:34PM 1 Negative Binomial Regression
6:32PM 7 Legality Question about R's Open Source GNU GPL License
6:10PM 3 Fill in NA values in vector with previous character/factor
5:36PM 3 Case statements in R
5:07PM 0 Question about the SSOAP package
4:57PM 1 Overlay of simple plots
4:53PM 5 rollapply() opertation on ts matrix
4:14PM 1 multiv
3:59PM 1 RStem with portuguese language
3:47PM 0 Bootstrapping
2:54PM 2 writing the plots
2:44PM 4 RODBC to query an Oracle table
1:32PM 2 how to add notes to the graph?
1:15PM 3 speeding up loop and dealing wtih memory problems
12:38PM 0 Rv: Chi-square parameter estimation
12:28PM 0 randomSurvivalForest 3.5.0 now available
12:14PM 1 Converting from char to POSIX:
10:19AM 2 axis.break on Date-x-axis in lattice xyplot
9:43AM 0 Help with yaImpute
8:54AM 0 I can not see help.start() in Ubuntu.
6:08AM 1 How to set directory Rscript runs in/Sweave output directory
5:21AM 1 Are there any packages that can process images other than pixelmap (i.e. pnm)?
4:20AM 2 Help with a loop
3:26AM 2 read.table question
2:06AM 1 Mixed model question.
12:32AM 2 Converting english words to numeric equivalents
12:12AM 1 Interpolating a line and then summing there values for a diurnal oxygen curve (zoo object)
 
Sunday July 27 2008
TimeRepliesSubject
10:29PM 0 Rolling regression - o/p selected coefficients
10:20PM 4 product of successive rows
8:32PM 1 help with durbin.watson
7:39PM 1 64-bit R on Mac OS X 10.5.4
7:36PM 0 Fitting a Bivariate Poisson log-normal distribution
7:10PM 2 Colors in Sweave
6:51PM 2 Link functions in SEM
6:29PM 2 equivalent R functions for Numerical Recipes fitxy and fitexy ?
2:24PM 0 competing risk model with time dependent covariates under R or Splus
11:55AM 4 Object-oriented programming in R for Java programmers?
11:01AM 0 re sponse surface analysis
7:45AM 1 Color of box frame in Legend (Was: Matrix barplot)
7:39AM 1 A easy way to write formula
7:34AM 1 Retain plot?
7:05AM 1 Complex to polar?
5:00AM 1 Lattice wireframe: How to avoid drawing lines around polygons when using shade=TRUE
4:39AM 1 Transfer Function Modeling
 
Saturday July 26 2008
TimeRepliesSubject
11:07PM 1 Coarsening the Resolution of a Dataset
9:42PM 2 Spatial Sample
9:26PM 4 Data length mismatch.
9:12PM 2 Sample
8:26PM 2 GLS "no terms component" error
4:00PM 1 Can't get the correct order from melt.data.frame of reshape library.
3:37PM 2 Beginning lm
3:30PM 1 Marking Interval Length
3:24PM 0 .Rprofile in RFrameworks?
3:17PM 1 issues with gap.plot function
3:16PM 1 Add a Vector to a Matrix
2:19PM 1 Remove non-numerical columns from data frame
12:43PM 0 competing risk model with time dependent covariates
11:47AM 2 response surface analysis
11:40AM 1 S-PLUS code in R
9:59AM 0 Help to Text Windoes in Menu with TCL-TK
9:08AM 0 gam() of package "mgcv" and anova()
4:52AM 1 error in test
4:06AM 1 Simple vector question.
3:30AM 1 Help with matrix
12:07AM 1 64-bit R on Mac OS X 10.4.5
12:00AM 4 parametric bootstrap
 
Friday July 25 2008
TimeRepliesSubject
10:43PM 0 fit.dist gnlm question, NaN and Inf results
9:54PM 1 Thin frame line around R pdf output in LaTeX
9:32PM 1 Matrix from List
9:18PM 0 Error in vector("double", length)
9:06PM 3 Numerical question
8:28PM 1 How to pass function argument of same name to internal call?
8:20PM 0 R-pmg (poor man gui) question
8:01PM 2 graphing regression coefficients and standard errors
7:50PM 0 Pairs() function: selective changing of ylim; use of key
7:39PM 0 s-plus in R... simpler code
7:31PM 1 Selecting the first measurement only from a longitudinal sequence
7:23PM 1 Percentile Estimation From Kernel Density Estimate
7:01PM 1 create multi windows plot at the same time
6:49PM 0 need help in parametric bootstrap
6:24PM 1 transcript a matlab code in R
6:13PM 1 Minor Bug in Documentation of merge()
4:13PM 1 plot zoo custom panel help
3:52PM 1 Interactive plot using playwith() and abline
2:49PM 3 melting a list: basic question
2:41PM 0 Package np version 0.20-0 released to CRAN
2:27PM 1 Saving a workspace with "extras"?
2:27PM 1 Insert rows into a pre-existing data frame
2:03PM 1 Chi-square parameter estimation
1:53PM 0 "Multiple" Regressions indexed by goodness of fit
1:40PM 1 S4 class and Package NAMESPACE [NC]
1:23PM 1 Scatterplot matrix one column vs. the rest of the dataset
1:08PM 1 Plink bed files
1:07PM 3 Maximization under constraits
12:51PM 1 extracting Pr>ltl from robcov/ols (Design)
12:49PM 0 Errror in running R2.7.1 version to R2.6.2 version
12:40PM 1 pca
12:13PM 4 Matrix barplot
11:03AM 1 Write lower half of distance matrix only
10:33AM 1 Building a data frame with missing data
10:29AM 1 Tutorial on rgl Graphics
10:26AM 1 cannot allocate vector of size...
9:36AM 0 Three contrast matrices on the same linear model
9:34AM 0 glht after lmer with "$S4class-" and "missing model.matrix-" errors with DATA
9:27AM 1 glht after lmer with "$S4class-" and "missing model.matrix-" errors
9:07AM 3 Help with rep
9:02AM 0 discrete event simulation - "factory" with rework
8:54AM 2 Package Hmisc, functions summary.formula() and latex(), options pdig, pctdig, eps and prmsd
6:34AM 2 problem in choosing cran mirror !
6:19AM 2 Fit a 3-Dimensional Line to Data Points
3:26AM 1 Installation error for RCurl in Redhat enterrpise 5
3:19AM 3 Bug in gap.plot
3:02AM 0 nlminb--lower bound for parameters are dependent on each others
2:03AM 1 Relying on R to generate html tables with hyperlinks and pictures ?
1:13AM 1 Create an R package
1:07AM 2 Rolling range and regression calculations
12:46AM 2 How to preserve the numeric format and digits ?
 
Thursday July 24 2008
TimeRepliesSubject
11:35PM 2 simple random number generation
10:40PM 0 ANNOUNCE: rapache 1.1.0 release
10:25PM 0 OT: course in research administration
10:09PM 1 Installing R packages in Textmate
10:07PM 3 Integrating R and Textmate
9:58PM 1 still more dumb questions
8:29PM 3 Should this PDF render correctly without font embedding?
8:25PM 0 SPR experiment: using lmer, transforming data, collinearity, and using a covariable
8:19PM 1 Cairo graphics
8:13PM 1 ggplot2 help
7:19PM 2 factor question
6:04PM 0 Problem with GLS dwtest function
5:42PM 1 R-package install
5:37PM 1 Parallel Processing and Linear Regression
5:13PM 1 Formatting Syntax when Merging
3:31PM 2 Help with which()
3:30PM 2 What is wrong with this contrast matrix?
2:55PM 1 [Fwd: Re: Coefficients of Logistic Regression from bootstrap - how to get them?]
2:06PM 1 Error - unable to load shared library
2:00PM 5 How to delete duplicate cases?
1:57PM 4 Dividing by 0
1:47PM 1 how know the status of particular process
1:36PM 0 Multinomial logistic regression with non-numerical data.
12:59PM 3 incrementing for loop by 2
12:09PM 2 NAs - NAs are not allowed in subscripted assignments
12:02PM 1 Problem with scatterplot3d example
11:07AM 0 Problems with Rmpi and LAM 7.1.4
11:01AM 4 Just 2 more questions - for now!
10:55AM 0 Bootstraping GAMs: confidence intervals
10:38AM 0 unable to load a library
10:30AM 4 Is there an equivalent * operator?
10:04AM 1 How to get rule number in arules
9:54AM 1 Coconut benchmark for R?
8:59AM 1 time zone - best way to shift hours
7:23AM 1 ggplot question
6:23AM 1 convert a vector of words into a matrix
3:18AM 2 Can R fill in missing values?
1:29AM 3 how to export ".xls" file with colorful cells?
 
Wednesday July 23 2008
TimeRepliesSubject
11:02PM 1 Aggregating zoo object with NAs in multiple column
10:51PM 2 path and R CMD check
10:03PM 0 Simulating multilevel responses
9:53PM 3 how can I write code to detect whether the machine is Windows or Linux?
9:49PM 1 R2WinBUGS problem
8:55PM 2 Weighted variance function?
8:33PM 4 Using PrettyR to produce LaTeX output
7:45PM 0 pvclust
7:41PM 2 truncated normal
7:39PM 3 Constrained coefficients in lm (correction)
7:35PM 0 Constrained coefficients in lm
7:24PM 0 Fw: Using if, else statements
7:12PM 2 Point-biserial correlation
7:03PM 1 Sample on dataframe
6:49PM 1 Questions on weighted least squares
6:47PM 1 Q re iterating a process and appending results to output file
6:29PM 5 Histogram
5:43PM 3 sum each row and output results
4:23PM 2 Flip Matrix form file?
4:20PM 2 shQuote and cat
4:05PM 2 Warning message in if else statement
3:44PM 6 Using if, else statements
3:12PM 2 Using RODBC to use SQL queries
2:06PM 1 Calling LISP programs in R
2:03PM 8 sequential sum of a vector...
1:49PM 0 How to control the memory?
1:23PM 6 Convert list of lists <--> data frame
1:14PM 1 [Fwd: Re: Coefficients of Logistic Regression from bootstrap - how to get them?]
1:07PM 3 Quantitative analysis of non-standard scatter plots.
12:55PM 1 Time series reliability questions
12:54PM 18 Simple... but...
10:39AM 3 maximum likelihood method to fit a model
9:56AM 6 par() function does not work
8:21AM 1 Combining 4th column from 30 files
7:06AM 1 mle2(): logarithm of negative pdfs
4:07AM 0 rpart node number
3:43AM 2 Can't Load Text Files
2:02AM 1 select significant variables
1:57AM 3 average replicate probe values
1:54AM 1 an extremely simple question
1:12AM 0 deblur microscope image stacks
12:22AM 1 rpart confidence intervals?
 
Tuesday July 22 2008
TimeRepliesSubject
11:05PM 2 Plotting Multiple lines on one plot
10:40PM 2 F test
9:49PM 1 TextMate and R
8:31PM 2 How to....
8:28PM 1 Reading the data from specific columns
8:22PM 2 Cannot re-start R after bus error
8:18PM 2 Decoding subscripts/superscripts from CSVs
7:52PM 1 help with simulate AR(1) data
7:24PM 1 .asp (not really an R question) but related
7:12PM 0 help on R benchmarks
7:04PM 1 rollmean and stl
6:59PM 1 How to simulate heteroscedasticity (correlation)
6:51PM 4 Function Error
5:59PM 2 Help with rearranging data
5:48PM 2 Editor for Mac
5:16PM 0 2 Courses*** R/Splus Advanced Programming : August 14-15 in Seattle ! by XLSolutions Corp
4:40PM 1 tklistbox and extracting selection to R
4:25PM 2 S4 : setGeneric for classical methods
4:24PM 1 data transformation
1:57PM 2 Does R have SQL interface in windows?
1:50PM 2 saving plot both as jpg and pdf
1:50PM 1 normalised/transformed regressions
1:47PM 5 How to filter a data frame?
1:34PM 0 Ignore previous emails
1:24PM 4 Opening files from R terminal - appologies
1:18PM 0 loop for multiple regressions
1:02PM 3 Error in installing packages
11:58AM 2 randomForest Tutorial
9:44AM 2 rpart$where and predict.rpart
8:42AM 1 scatter plot using ggplot
8:12AM 1 Urgent
8:00AM 1 determing font type in expression
7:59AM 2 Table orderd by frequencies
6:26AM 1 xyplot help
4:44AM 1 Accessing individual variables from summary of lm
1:42AM 1 Lattice: How to draw curves from given formulae
 
Monday July 21 2008
TimeRepliesSubject
11:24PM 4 how to speed up this for loop?
9:55PM 1 Large number of dummy variables
9:21PM 0 how to draw multiples curses (for given formulae) in lattice
9:17PM 1 y-axis number format on plot, barplot etc.
9:00PM 0 Table of tables?
8:56PM 1 Using integrate
7:35PM 0 optimize function help!!
6:49PM 3 vector help
6:31PM 1 Control parameter of the optim( ): parscale
5:39PM 3 Editor fpr Mac OS
5:02PM 2 Output Nicely formatted tables from R
3:49PM 1 Parameter names in nls
3:39PM 1 Mclust - which cluster is each observation in?
3:22PM 1 dev2bitmap error, 'gs' cannot be found
3:20PM 0 xyplot: distance between axis and axis-label gets wrong
3:12PM 2 Creation of png=problems
3:04PM 5 Coefficients of Logistic Regression from bootstrap - how to get them?
2:56PM 1 portfolio optimization problem - use R
2:54PM 2 avoid loop with three-dimensional array
2:00PM 1 alternate usage of soil.texture (plotrix)
1:31PM 1 Subsetting data by date
1:12PM 1 Howto Restart A Function with Try-Error Catch
12:52PM 1 Cross correlation significance test
12:13PM 2 Getting plot axes where they should be!
11:35AM 2 Time Series - Long Memory Estimation
11:15AM 0 help with integrate function
10:32AM 1 On creating grouped data set.
9:11AM 1 fama-macbeth
9:10AM 2 sampling from a list of values while excluding one
9:03AM 0 A question on the quandratic programming
7:52AM 1 CART Analysis
7:27AM 0 SVM: Graphical representation
6:09AM 2 CART and CHAID
2:35AM 1 RODBC - problems using odbcDriverConnect without DSN
1:03AM 3 Lattice Version of grconvertX or variant on panel.text?
 
Sunday July 20 2008
TimeRepliesSubject
11:16PM 0 coin package (conditional inference / permutation): parameter teststat
11:16PM 1 Sum efficiently from large matrix according to re-occuring levels of factor?
8:33PM 3 enumerate subsets
7:24PM 2 Erro: cannot allocate vector of size 216.0 Mb
7:03PM 0 Off topic: SS formulae for 3-way repeated measure anova (for when aov() fails)
5:27PM 3 asp and ylim
4:48PM 2 Erro updating HTML package descriptions in packages.html
4:44PM 2 Conditionally Updating Lattice Plots
4:34PM 2 fill in area between 2 lines with a color
4:12PM 2 Indicator Kriging?
1:42PM 4 Access to values of function arguments
1:36PM 0 How do I install Joomla! 1.5?
12:44PM 4 drawing segments through points with pch=1
11:32AM 3 Order of columns(variables) in dataframe
11:19AM 1 Error in edit(name,file,title,editor)
10:41AM 2 R interprets symbol as q()
7:45AM 2 problem with read.table
2:46AM 1 confusion matrix in randomForest
 
Saturday July 19 2008
TimeRepliesSubject
10:10PM 2 Non-linearly constrained optimisation
9:21PM 1 estimating volume from xyz points
8:02PM 1 wroung groupedData despite reading Bates and Pinheiro 3 times
6:30PM 1 replicate matrix blocks different numbers of times into new matrix
6:16PM 1 Sweave add code \201
4:04PM 2 extracting colnames to label plots in a function
3:47PM 1 principal factor analysis
3:14PM 0 fixed effect significance with lmer() vs. t-test
2:07PM 1 Resshufling algorithm (Thiago Souza)
1:10PM 1 Discretize continous variables....
10:29AM 2 Title for graph with multiple plots
7:35AM 3 R version 2.7.1 (warnings)
6:09AM 3 Graphics not working for R in ubuntu
12:20AM 2 How to solve systems of nonlinear equations in R?
 
Friday July 18 2008
TimeRepliesSubject
11:13PM 0 Retrieving data from a tcl /tk function
11:00PM 1 problem with putting text in outer margins (mtext outer=TRUE)
10:21PM 2 with lapply() how can you retrieve the name of the object
10:17PM 0 spreading the risk
9:26PM 1 system time - windows specific problem
7:51PM 1 Calculating Betweenness - Efficiency problem
7:11PM 1 Functions similar to step() and all.effects() that work for lme() objects?
6:42PM 3 using which to identify a range of values
6:24PM 3 "Spreading risk" in a matrix
5:52PM 0 copy number estimation through oligo package?
5:24PM 0 Polynomial Approximation with Exponential Kernel
4:44PM 3 How to cut data elements included in a text line
4:37PM 1 par("din") vs dev.size()
4:08PM 1 cbind help
3:51PM 1 re ad and check table
3:46PM 0 dataedit
3:10PM 1 manipulate a matrix2
3:04PM 2 Landscape mode for pdf
2:03PM 1 creating names for lists
2:01PM 0 A neural network problem---neuralnet package
1:37PM 2 source code functions
12:53PM 1 only "T" becomes logical colum with read.table
12:37PM 3 Change font-face in title
12:21PM 2 generate repeats of a vector's elements
12:11PM 5 Reading SPSS .por files
11:45AM 2 name returned by lapply
11:41AM 0 Correction: RStat version 2.7.*1* now available
10:50AM 0 RStat version 2.7.2 now available
10:47AM 1 finding "chuncks" of data that have no NA s
10:15AM 1 t-test for multiple variables
9:27AM 0 Equation sequencing
7:36AM 2 column wise paste of data.frames
7:24AM 1 function "eigen" AND Minitab
7:18AM 0 Installation of garchOxFit
1:47AM 2 matrix multiplication question
12:36AM 0 How to convert/map jacktest results to dataframe or file
 
Thursday July 17 2008
TimeRepliesSubject
11:09PM 3 Problem with TLC/TK on Ubuntu
9:31PM 1 combining lists of pairs
9:01PM 0 Help with data layout - Thanks
8:57PM 1 smooth.spline
8:54PM 2 nested calls, variable scope
8:42PM 4 Matching Up Values
6:54PM 1 ubuntu and rgl package vs suse ?? static plots
5:47PM 3 Display variables when running a script
5:40PM 4 REvolution computing
4:22PM 0 Can mvtnorm calculate a sequence of probabilities?
4:08PM 0 keeping seperate row.names
3:57PM 3 Hiding information about functions in newly developed packages
3:50PM 4 help with data layout
3:32PM 1 Newbie's question about lm
3:29PM 2 Sampling distribution (PDF & CDF) of correlation
2:25PM 3 Colours in R
2:14PM 3 Graph
2:06PM 1 Comparing differences in AUC from 2 different models
1:58PM 1 errors using step function
1:44PM 0 Re : Re : float and double precision with C code
1:25PM 0 Re : float and double precision with C code
12:47PM 1 float and double precision with C code
12:47PM 0 how to split the string
12:26PM 1 histogram plot default
12:26PM 2 spliting a string
11:37AM 2 fastICA
9:49AM 0 model.tables standard errors
9:47AM 5 calculate differences - strange outcome
9:33AM 0 How to compute loglikelihood of Lognormal distribution
9:13AM 3 Histogram with two colors depending on condition
5:41AM 2 Fw: how i can install Rgraphviz in R2.7.1
2:27AM 2 Location of HTML help files
1:11AM 0 create a function from a model
12:17AM 1 plot(linear model) without lines
 
Wednesday July 16 2008
TimeRepliesSubject
11:45PM 2 Stratified random sample
10:26PM 3 Function to verify existence of an R object
9:27PM 2 spectral decomposition for near-singular pd matrices
8:17PM 2 Labelling curves on graphs
8:14PM 1 RSQLite maximum table size
7:09PM 1 help with bivariate density plot question
6:51PM 2 gstat problem with lidar data
4:47PM 0 Help with rpart.predict?
4:43PM 0 Confidence bands for model estimates using ns() spline basis
4:08PM 4 Likelihood ratio test between glm and glmer fits
4:06PM 1 Problem with mpi.close.Rslaves()
3:57PM 0 Forecasting enrollments with fuzzy time series
3:56PM 1 Help regarding arules package
3:51PM 1 Output design question
1:10PM 1 NAMESPACE vs internal.Rd
12:29PM 1 R-source code of a function
11:41AM 1 date to decimal date conversion
10:48AM 2 barchart with bars attached to y=0-line
8:21AM 2 Group level frequencies
7:28AM 2 Howto view function's source code of an installed package
5:40AM 0 Simulate data with binary outcome
5:32AM 1 negative P-values with shapiro.test
4:03AM 0 Off-topic - Data needed
3:55AM 2 How to extract component number of RMSEP in RMSEP plot
1:48AM 1 Help Updating and Installing R Packages
12:40AM 1 R logo
 
Tuesday July 15 2008
TimeRepliesSubject
11:58PM 0 implementation of Prentice method in cch()
11:51PM 2 New Zealand Maps
9:51PM 1 What package to use to create a GUI
9:35PM 2 Row Sum, exclude positive values
9:00PM 3 Melt (reshape) question
8:37PM 1 Filtering output
8:20PM 2 sem & testing multiple hypotheses with BIC
7:51PM 0 generalized spatial autoregressive lag model
7:50PM 2 POSIXct extract time
7:34PM 0 how to get confidential interval for classification accuracy using 10-fold validation in svm package
7:21PM 1 code reduction (if anyone feels like it)
6:53PM 0 INSEED statistics workshop on Statistical Models and Practices in Epidemiology (using R)
6:51PM 0 INSEED Statistics Workshop on Bayesian statistics using OpenBUGS and R
5:52PM 0 Help with maptools sunriset()
5:12PM 1 aov error with large data set
5:11PM 4 Iterations
4:52PM 1 sunrise sunset calculations
4:33PM 0 Calculating Stream Metabolism
3:27PM 5 counting number of "G" in "TCGGGGGACAATCGGTAACCCGTCT"
3:09PM 2 extracting elements from print object of Manova()
2:19PM 0 DOE for logistic models
2:08PM 2 Problem installing R on openSUSE 10.3
1:42PM 3 Font quality in base graphics
1:07PM 1 manipulating (extracting) data from distance matrices
1:00PM 0 creating axis of the plot before data are plotted -- solved
12:40PM 3 playwith package crashes on Mac
12:16PM 4 Mapping data onto score
12:16PM 1 Mapping data onto 1-10 score
12:02PM 2 Regression problem
11:41AM 0 linear and non linear regression in 3D !
11:05AM 2 Layers in graphs
10:59AM 1 tryCatch - return from function to main script
9:41AM 0 Odd behavior of remove command
8:33AM 1 Supressing printing from a function: ecdf
7:56AM 1 Proxy again, this time on a Mac
6:57AM 2 enscript states file for R scripts?
4:34AM 2 meaning of tests presented in anova(ols(...)) {Design package}
4:33AM 0 [Ask]Robust Buckley-James like estimator
1:36AM 0 r^2 for SSasymp?
 
Monday July 14 2008
TimeRepliesSubject
11:07PM 2 long data frame selection error
10:57PM 2 position of a specific character
10:24PM 2 modeling binary response variables
10:16PM 2 question about a small "for" loop
10:10PM 0 [Fwd: Re: Insurance review statistical methods]
9:51PM 0 rgl.snapshot on linux produces colored lines only
9:47PM 2 Insurance review statistical methods
9:44PM 0 Extract and plot array from data
9:40PM 2 Convert data set to data frame
9:29PM 3 Data Manipulations and SQL
9:26PM 1 Function to create variables with prefix
8:47PM 3 statistics question about a statement in julian faraway's "extending the linear model with R" text
6:50PM 1 Analysis of poorly replicated array data
6:34PM 2 .First and .Rprofile won't run on startup
6:09PM 2 Backslash in sub pattern?
5:56PM 1 R Commander question
4:49PM 1 dll problem
3:49PM 1 Help with an error message
3:46PM 0 .Last() and namespace
3:21PM 1 creating axis of the plot before data are plotted
3:03PM 1 macros in R
3:00PM 5 A question about using function plot
2:39PM 0 swap_tail macro in pnorm.c
2:39PM 1 applying complex functions by groups
2:23PM 0 ampersand char in the path causing error message when running rscript.bat
1:38PM 0 Can't compile in HPUX 11.31 on IA64
12:37PM 2 aggregate months to years
11:50AM 1 options() question for displaying numbers in the GUI
11:18AM 1 How to load stats4 package
10:41AM 1 Tissue specific genes by ANOVA?
10:20AM 2 how to correlate nominal variables?
10:18AM 0 "Reasonable doubt" - was "Re: shapiro wilk normality test"
10:16AM 0 Frequency-Table on Group Level - Multi Level Analysis
10:07AM 0 nlme, lme( ) convergence and selection of effects
9:04AM 1 eval.wih.vis
8:45AM 1 rm(l*)
8:33AM 3 Loop problem
7:50AM 0 Question regarding lmer vs glmmPQL vs glmm.admb model on a negative binomial distributed dependent variable
7:03AM 1 How to extract folowing data?
6:04AM 1 source code for R-dev packages
5:41AM 0 Using Internals via their compiled sources
1:57AM 1 Off topic: Tcl/Tk outside R.
1:03AM 1 Computing row means for sets of 2 columns
12:34AM 0 Moran's I- Ordinal Logistic Regression
12:24AM 0 Moran's I test- Ordinal Logistic Regression Model
 
Sunday July 13 2008
TimeRepliesSubject
10:31PM 2 any way to set defaults for par?
9:40PM 1 stem and leaf plot: how to edit the stem-values
8:05PM 1 (no subject)
7:19PM 0 rm anova
4:47PM 3 initialize a factor vector
 
Saturday July 12 2008
TimeRepliesSubject
10:09PM 0 A (not so) Short Introduction to S4
8:23PM 1 How to build a package which loads Rgraphviz (if installed)...
7:50PM 1 Installing RWinEdt
7:46PM 2 Excel Trend Function
7:22PM 0 R-outlet: Journal of Statistical Software
5:28PM 0 Reading Multi-value data fields for descriptive analysis (resend)
4:37PM 1 Reading Multi-value data fields for descriptive analysis
3:30PM 5 shapiro wilk normality test
3:23PM 4 problem
2:12PM 2 Quick plotmath question
1:23PM 0 Visualization of multiple alignments
11:23AM 1 a warning message from lmer
7:56AM 1 Error of exp() in a dll from Fortran
7:48AM 1 Help with arima.sim
7:32AM 1 Assoociative array?
6:57AM 1 Another packaging question
3:32AM 3 Another failed attempt to install an R package in Ubuntu
 
Friday July 11 2008
TimeRepliesSubject
10:47PM 1 data summarization etc...
10:44PM 3 data summerization etc...
8:38PM 1 Plot multiple datasets on a VCD ternary graph
7:57PM 3 List help
6:25PM 2 plotting granular data
5:57PM 1 Difficultes with grep
5:06PM 1 While loop
4:48PM 2 Help with error in "if then" statement
4:42PM 0 GroupedData for three way randomized block. LME
4:25PM 1 reading in a subset of a large data set
3:51PM 1 Comparing complex numbers
3:50PM 1 More compact form of lm object that can be used for prediction?
3:41PM 1 mpirun question with Rmpi
3:30PM 1 TeachingDemos question: my.symbols() alignment problems in complicated layout
2:53PM 1 Subsetting an array by a vector of dimensions
2:53PM 1 Meaning of Positive LogLikelihood
1:56PM 0 modified ks.test?
1:04PM 2 network
12:37PM 0 Funnel plots
10:35AM 0 Funnel plots in r
9:43AM 0 how to test this multivariate normal distribution?
9:42AM 3 Start preferred RGui
8:22AM 1 Any R package about COALESCENT THEORY/GENEOLOGICAL TREES??
5:13AM 1 How to output 0.405852702657738 as 0.405853 ?
1:46AM 3 number of effective tests
12:47AM 2 Problems with Package Installation.
 
Thursday July 10 2008
TimeRepliesSubject
11:00PM 2 princomp loading help
10:07PM 1 R bug in the update of nlme?
10:03PM 1 odfWeave problem in 7.1?
8:54PM 0 predict.garch problem
8:43PM 1 Interpretation of EXACT Statistical Test in finding the probability as Std. Deviations (SumP)
8:28PM 1 layout is to xyplot as ??? is to qplot
8:07PM 5 rounding
6:51PM 1 Ellipsis arguments for plot.formula
6:39PM 1 search with help.start
6:27PM 1 compiling pnmath on an intel processor running mac OS 10.5
6:21PM 3 Sorting a matrix
5:11PM 0 Rmpi unkown input format error
4:50PM 1 embarrassingly parallel problem - simple loop solution
4:49PM 3 What's the T-Value in fisher.test
4:21PM 0 by() function doesn't work inside another function
3:45PM 1 S4 class questions
3:28PM 0 ppls: version 1.02 including a new data set
3:21PM 0 ace error because of missings?
3:13PM 0 How to check how much memory has been used or reserved ?
2:41PM 2 false discovery rate !
2:35PM 2 xYplot customizing y-axis scaling
2:01PM 1 Non-normal data issues in PhD software engineering experiment
12:41PM 2 Position in a vector of the last value > n
11:56AM 4 Turn any vector
11:55AM 0 Bootstrap in betareg()
10:44AM 1 quantile regression estimation results
10:22AM 3 Sorting / editing a table
9:44AM 1 problems with rq.fit.sfn
8:54AM 1 Operator overloading
6:15AM 4 Interpolation of data
6:10AM 3 specifying data
6:04AM 2 Finding Values that Occur Most Often in a Vector
4:47AM 2 Lattice: merged strips?
4:04AM 1 “Check” problem
1:15AM 1 Basic help needed
12:50AM 2 Help on Installing Matrix Package in Linux (Fedora)
 
Wednesday July 9 2008
TimeRepliesSubject
11:07PM 0 Help navigating documentation for descriptive statistics
10:33PM 1 use variable value as vector name
10:02PM 3 Grid building in R
9:38PM 1 zoo and cex
8:26PM 1 matplot help
8:24PM 1 read.table problem
7:17PM 3 randomly select duplicated entries
7:16PM 2 Read.table - Less rows than original data
6:57PM 1 Sweave figure
6:57PM 2 shifting data in matrix by n rows
6:51PM 0 ftp directory
6:45PM 0 garchFit problem
6:31PM 0 "Rotated Lat-Lon" projection in mapproj
6:26PM 0 question on FARIMA innovations
5:49PM 1 outlining symbol in legend with blackline
5:30PM 3 rbinom for a matrix
5:01PM 1 Question regarding lu in package Matrix
4:50PM 2 rollmean()
4:42PM 2 Port package
4:15PM 2 build matrix with the content of one column of a data frame in function of two factors
3:56PM 0 rJava crashes jvm
3:49PM 2 gsub and "\"
3:28PM 4 Find the closest value in a list or matrix
3:26PM 1 lapply
3:15PM 5 Summary Stats (not summary(x))
12:34PM 1 netCDF to TIFF
11:00AM 1 childNames for xaxis grob (grid package)
10:59AM 0 RJDBC and OracleDriver: unable to connect
10:36AM 1 plot gam "main effect functions" in one graph
10:20AM 1 version problems of rkward in ubuntu hardy repository
10:09AM 4 Strptime/ date time classes
9:58AM 0 problems using mice()
9:55AM 0 Question concerning Furness iteration & subprogram/modules
9:40AM 7 recursively divide a value to get a sequence
9:34AM 1 "non-sample" standard-deviation
9:33AM 2 Parsing
9:21AM 3 Expression in axis
9:13AM 2 replacing value in column of data frame
8:29AM 1 building experimental paradigm with R as "Brainard/Pelli Psych Toolbox"
7:40AM 1 Help with installing add-on packages
5:21AM 0 Installing R package but got Fortran 90 error
4:06AM 1 Loglikelihood for x factorial?
2:58AM 2 sorting a data frame by rownames
2:52AM 2 cex.axis for the x axis
 
Tuesday July 8 2008
TimeRepliesSubject
8:56PM 1 aggregate() function and na.rm = TRUE
8:14PM 1 calculation of entropy in R???
7:55PM 0 Fwd: Re: extracting index list when using tapply()
6:33PM 2 nls and "plinear" algorithm
6:31PM 6 Automatic placement of Legends
6:23PM 3 extracting index list when using tapply()
5:43PM 1 making zoo objects with zoo without format argument?
5:39PM 1 Plot
5:23PM 2 How I count the all possible samples??
4:58PM 1 R crash with ATLAS precompiled Rblas.dll on Windows XP Core2 Duo
4:57PM 0 Gage R & R
4:42PM 1 fisher.test
3:58PM 0 How to draw dot plots for 2 vectors seperately
3:36PM 0 simulate data for lme
2:53PM 1 R package
2:25PM 2 time series by calendar week
1:36PM 0 Specific question on LDheatmap
1:32PM 1 about EM algorithm
1:28PM 0 help for xvalid with external data
1:18PM 6 Question: Beginner stuck in a R cycle
12:53PM 3 Can I do regression by steps?
12:45PM 0 workspace platform potabillity
11:57AM 1 Help with eigenvectors
11:43AM 0 Multiple Plots and y Axis Labels
11:22AM 4 Histogram with colors according to factor
11:11AM 4 Manipulate Data (with regular expressions)
11:07AM 0 Change legend in the 'hydrogeo' package
10:36AM 0 forecast & xreg
10:28AM 2 Constrained optimization
9:40AM 2 attributing values to dataframe positions following eval
8:36AM 1 package segmented problem
8:14AM 1 shading an area in a edf
8:11AM 0 what does this warning mean ?
8:00AM 2 How to change labels in a histogram
7:38AM 2 Change in behaviour of sd()
5:59AM 4 Can R do this ?
5:58AM 8 Sum(Random Numbers)=100
4:41AM 1 odd dnorm behaviour (?)
3:59AM 2 list genes w/n a genomic fragment
 
Monday July 7 2008
TimeRepliesSubject
11:56PM 5 question on lm or glm matrix of coeficients X test data terms
9:07PM 5 Basic Vector and Matrix Operations
7:19PM 3 subset() multiple arguments
6:42PM 1 Interest in a Use R Group in San Francisco area?
6:03PM 2 A shorter version of ".Last.value"?
5:51PM 2 Colour clusters in a 2d plot
4:06PM 2 Drawing a colour wheel - bug in hcl?
3:18PM 2 Running "all possible subsets" of a GLM (binomial) model
2:45PM 1 Plot depends on conditions
1:38PM 3 A quick question about lm()
12:29PM 2 Sorting a list
9:44AM 0 Howto Initialize Parameter of Gamma Mixture Densities for EM
9:19AM 2 indicating significant differences in boxplots
9:17AM 1 How can I optimize this piece of code ?
9:15AM 2 one-site competition data // curve fitting
8:49AM 1 Change language in Rcmdr
7:48AM 1 GLM, LMER, GEE interpretation
3:24AM 4 Plot Mixtures of Synthetically Generated Gamma Distributions
2:48AM 0 Functional Data Analysis, fda_1.2.4
1:39AM 5 How can i do an automatic upgrade of R 2.5.1 to R 2.7.1
 
Sunday July 6 2008
TimeRepliesSubject
11:50PM 4 Method for checking automatically which distribtions fits a data
11:36PM 1 Exception Handling
11:35PM 0 color with tcl/tk?
10:34PM 4 Numbers as Points in Graphs
9:41PM 2 Issue with postscript figures using WinAnsi encoding
9:17PM 2 Regular expressions: bug or misunderstanding?
8:07PM 0 Benchmarking R and R Workloads
7:36PM 1 ts.plot
7:19PM 5 Error in defining function
6:07PM 1 What is my replication unit? Lmer for binary longitudinal data with blocks and two treaments.
4:01PM 2 Hi~problem with the two sample test: ks2Test in the package of fbasics
3:39PM 3 Lots of huge matrices, for-loops, speed
2:37PM 1 Windows Only: winMenuAdd() problem
2:24PM 1 Backgrounds in Multiple Plots made with "fig"
1:32PM 1 Interpreting messages when building packages
11:52AM 1 lattice smooth problem?
8:59AM 2 looking for alternative of 'if-else'
6:13AM 2 lattice question
5:22AM 1 Different Autocorrelation using R and other softwares
1:44AM 2 Error: cannot use PQL when using lmer
12:51AM 1 interpreting mixed model anova results
 
Saturday July 5 2008
TimeRepliesSubject
10:14PM 0 Problem solved: extracting values from a "by" function
9:59PM 0 extracting values from a "by" function
7:25PM 1 Random Forest %var(y)
6:55PM 1 SciViews GUI
4:13PM 5 help about random generation of a Normal distribution of several variables
8:17AM 2 Bland-Altman method to measure agreement with repeated measures
8:00AM 0 lattice smooth
7:26AM 3 trying to superimpose a line plot onto a histogram
4:14AM 2 p-value for Nonmetric Multidimentional Scaling?
 
Friday July 4 2008
TimeRepliesSubject
11:23PM 1 synthax for R CMD INSTALL
10:36PM 2 set type of SS in anova()
8:05PM 1 logistic regreesion and score test
6:42PM 0 RES: initialize a matrix
3:50PM 2 create a zero matrix & fill
3:18PM 1 Calling and running a compiled program inside R
2:38PM 4 Re ad in a file - produce independent vectors
2:22PM 1 initialize a matrix
1:57PM 1 update search path for attached data
1:40PM 1 Test for multiple comparisons: Nonlinear model, autocorrelation?
1:24PM 1 Repeated measures lme or anova
12:42PM 0 test for difference in variance
12:04PM 1 stop without error message
12:02PM 0 passing arguments to a R script
11:59AM 1 Hmisc latex: table column width
7:23AM 1 Problem in installing Biobase
7:08AM 1 kriging problem(?)
6:29AM 3 problem with NA and if
3:54AM 1 by or tapply?
 
Thursday July 3 2008
TimeRepliesSubject
10:49PM 1 Ternaryplot function
10:48PM 1 'as.Date' conversion of classes POSIX*t (problem/feature)?
10:04PM 3 apply with a division
9:25PM 1 subset function within a function
9:09PM 2 First attempt to use R
8:46PM 2 L1 nonlinear approximation
8:43PM 1 lines() warning message
8:37PM 1 Installation of packages via GUI, Mac OS X
8:14PM 1 Exporting a Graph that has lines()
7:36PM 0 FW: For loop
6:57PM 3 Recoding a variable
6:19PM 3 Re membering the last time an event occurred within a dataframe
5:59PM 2 Relative Mortality Risk second part
5:54PM 1 R-help Digest, Vol 65, Issue 4
5:33PM 0 Random effects and lme4
5:13PM 0 Biostatistician Positions at Vanderbilt University
3:52PM 0 Reproducibility and GUIs
2:40PM 1 read.table, NA assignment, and sep
2:04PM 1 cross-validation in rpart
1:38PM 1 ggplot2: scaling and tick mark of x-axis
1:35PM 2 How to emulate perl style of reading files ?
1:28PM 1 combining time series [was: (no subject)]
12:41PM 1 *** significance with xtable
12:14PM 0 loop calculation
11:41AM 1 Data size
9:25AM 1 Problem in applying conditional looping
9:15AM 2 PCA on image data
9:12AM 2 as.Date() clarification
8:02AM 2 Matrix set value problem
8:01AM 1 ggplot2 legend for vertical lines
7:52AM 2 latex styling for R regression outputs
7:38AM 0 (no subject)
7:38AM 0 post hoc comparisons on NLME for longitudinal data
7:37AM 1 RODBC Access limit?
6:41AM 1 randomForest.error: length of response must be the same as predictors
3:35AM 1 Otpmial initial centroid in kmeans
3:21AM 1 Processing 10^8 rows and 1^3 columns
2:43AM 1 lm() question
1:40AM 3 problem with lm and predict - no predictions made
1:33AM 1 how to capture matching words in a string ?
1:25AM 2 How do I paste double quotes arround a character string?
12:47AM 2 Plotting Prediction Surface with persp()
12:41AM 2 what can we do when R gives no response
12:17AM 1 Migrating from S-Plus to R - Exporting Tables
 
Wednesday July 2 2008
TimeRepliesSubject
11:24PM 0 neural networks
9:29PM 1 Removing or overwriting an XML node
9:17PM 1 set values in data.frame to NA conditional on another data.frame
7:56PM 1 exporting ftable
7:21PM 1 graph woes
7:20PM 0 Goodness of fit test
7:10PM 2 Accessing a field in a data fram
6:55PM 1 flow map lines between point pairs (latitude/longitude)
6:55PM 2 Reading CSV file with unequal record length
6:49PM 2 help appreciated to make a plot
6:02PM 1 heatmap
5:58PM 1 Problem with strucchange package
5:22PM 0 question on dispersion parameter
4:55PM 0 error on predict
4:30PM 5 multiplication question
4:23PM 1 auto.key in xyplot in conjunction with panel.text
4:22PM 1 Sunset in Dortmund
4:13PM 1 Extracting regression coef. and p-values in JRClient
4:04PM 2 get formatted regression output
3:58PM 1 Hmisc latex function with longtable option
3:37PM 1 help on list comparison
3:21PM 0 log plots woes
2:54PM 1 Multiple time series plots
2:52PM 1 Tobit Estimation with Panel Data
2:39PM 1 Insert text in data.frame
2:28PM 1 Usage of rJava (.jcall) with Weka functions, any example?
2:24PM 2 Problem reading from a data frame
1:44PM 1 randomForest training error
1:31PM 3 variable as part of file name
1:30PM 1 survival package test stats
1:25PM 1 Zoo plotting behavior
12:42PM 0 Question about GCL function
12:29PM 1 FW: RES: bug in axis.Date? was (Re: newbie needs help plottingtimeseries)
12:24PM 1 Can't install package Matrix on solaris.
10:53AM 1 how do I read only specific columns using read.csv or other read function
10:28AM 2 Correlation structures in gls with repeated measurements
10:05AM 0 Sweave / Latex per-chapter output
9:52AM 1 conversion of data for use within barchart
9:49AM 0 Combining playwith with par(mfrow... ) i.e., multiple plots.
9:41AM 2 position legend below x-axis title
8:41AM 2 Optimal lag selection in Granger Causality tests
3:20AM 0 Survival Analysis questions
2:43AM 0 forget my previous question
2:41AM 1 is there an equivalent of prop.table but for counts
2:10AM 1 Install Packages in Windows Vista
 
Tuesday July 1 2008
TimeRepliesSubject
11:49PM 4 passing a variable at the command line
11:16PM 1 adding a package in Windows
10:38PM 2 Area Under a Curve
10:20PM 2 Graph Order in xyplot
9:25PM 2 plot.zoo labels
7:17PM 3 Change name of a specific column of a data frame
7:15PM 3 plot window
7:11PM 2 Problem with loading library-ks
7:03PM 2 problem with mpiexec and Rmpi
6:28PM 2 Fitting a curve to data
6:15PM 5 WIERD: Basic computing in R
5:49PM 3 Ignore blank columns when reading a row from a table
5:12PM 1 Simulate from a GAM model
5:12PM 1 Orthogonal polynomials and poly
4:54PM 2 Prediction with Bayesian Network?
4:11PM 2 ignore warning messages?
3:49PM 2 how to automatically maximize the graph window (under XP) ?
3:21PM 2 "Invalid object" error in boxplot
3:14PM 1 Plotting Bi-Gamma Distribution
3:03PM 1 select.list() cannot be used non-interactively
2:54PM 0 Query on packages for Emerging Patterns
1:50PM 4 Find classes of each column of data.frame()
1:38PM 5 A regression problem using dummy variables
12:55PM 0 cohort sampling
12:46PM 5 trivial list question
12:40PM 2 if one of 4 conditions is not satisfied
10:20AM 3 dev.off() inside a function & other glitches
9:58AM 3 reshape matrices
9:17AM 2 Set default value
8:57AM 1 Help on Analysis of covariance
8:46AM 1 Installing R into home directory?
8:03AM 2 Are centre coordinates or upper left corners used of x, y for SpatialPixels?
7:40AM 1 extracting elements from a list in vectorized form
3:44AM 1 Messge ``no visible binding''.
2:08AM 2 PCA : Error in eigen(cv,
12:54AM 1 Help in using PCR