Dear all, I have a input file like following : AAAAT TTTAG TTAAC GGATT ACGTA How can I make a single vector with this like following: AAAATTTTAGTTAACGGATTACGTA Best regards Albert [[alternative HTML version deleted]]
On Thu, Jul 7, 2011 at 4:37 PM, albert coster <albertcoster2010@gmail.com>wrote:> Dear all, > > I have a input file like following : > > AAAAT > TTTAG > TTAAC > GGATT > ACGTA > > How can I make a single vector with this like > following: AAAATTTTAGTTAACGGATTACGTA >?paste, specifically the collapse argument Rainer> > Best regards > > Albert > > [[alternative HTML version deleted]] > > ______________________________________________ > R-help@r-project.org mailing list > https://stat.ethz.ch/mailman/listinfo/r-help > PLEASE do read the posting guide > http://www.R-project.org/posting-guide.html > and provide commented, minimal, self-contained, reproducible code. >-- Rainer M. Krug, PhD (Conservation Ecology, SUN), MSc (Conservation Biology, UCT), Dipl. Phys. (Germany) Centre of Excellence for Invasion Biology Stellenbosch University South Africa Tel : +33 - (0)9 53 10 27 44 Cell: +33 - (0)6 85 62 59 98 Fax (F): +33 - (0)9 58 10 27 44 Fax (D): +49 - (0)3 21 21 25 22 44 email: Rainer@krugs.de Skype: RMkrug [[alternative HTML version deleted]]
> x <- readLines(textConnection("AAAAT+ TTTAG + TTAAC + GGATT + ACGTA"))> closeAllConnections() > paste(x, collapse = '')[1] "AAAATTTTAGTTAACGGATTACGTA">On Thu, Jul 7, 2011 at 10:37 AM, albert coster <albertcoster2010 at gmail.com> wrote:> Dear all, > > I have a input file like following : > > AAAAT > TTTAG > TTAAC > GGATT > ACGTA > > How can I make a single vector with this like > following: AAAATTTTAGTTAACGGATTACGTA > > Best regards > > Albert > > ? ? ? ?[[alternative HTML version deleted]] > > ______________________________________________ > R-help at r-project.org mailing list > https://stat.ethz.ch/mailman/listinfo/r-help > PLEASE do read the posting guide http://www.R-project.org/posting-guide.html > and provide commented, minimal, self-contained, reproducible code. >-- Jim Holtman Data Munger Guru What is the problem that you are trying to solve?