search for: albertcoster2010

Displaying 3 results from an estimated 3 matches for "albertcoster2010".

data format
2011 Jul 07
2
data format
Dear all, I have a input file like following : AAAAT TTTAG TTAAC GGATT ACGTA How can I make a single vector with this like following: AAAATTTTAGTTAACGGATTACGTA Best regards Albert [[alternative HTML version deleted]]
problem in reading a sequence file
2011 Jul 05
3
problem in reading a sequence file
Dear all, I have a file with some sequence (seq.txt). I am writting following code and getting error! Can please help me? seqfile<-read.table(file="seq.txt") Warning message: In read.table(file = "seq.txt") : incomplete final line found by readTableHeader on 'seq.txt' Thanks in advance Albert -------------- next part -------------- NNNNNNNNNNATTAAAGGGC
how can I read a xlsx file
2011 Aug 15
3
how can I read a xlsx file
Hello, How can I read a xlsx file using xlsx package? Thanks Albert [[alternative HTML version deleted]]