search for: tttag

Displaying 1 result from an estimated 1 matches for "tttag".

Did you mean: ttag
2011 Jul 07
2
data format
Dear all, I have a input file like following : AAAAT TTTAG TTAAC GGATT ACGTA How can I make a single vector with this like following: AAAATTTTAGTTAACGGATTACGTA Best regards Albert [[alternative HTML version deleted]]