Instead of prepend or append new columns to a matrix, how to insert them to a matrix ? For example, I would like to insert 3 new columns after the 5th column of matrix m. _________________________________________________________________ [[elided Hotmail spam]] [[alternative HTML version deleted]]
Try something like this: m <- matrix(1:20, ncol = 5) cbind(m[, 1:3], matrix(1:16, ncol = 4), m[,4:ncol(m)]) On Tue, Jun 24, 2008 at 8:02 AM, Daren Tan <daren76@hotmail.com> wrote:> > Instead of prepend or append new columns to a matrix, how to insert them to > a matrix ? For example, I would like to insert 3 new columns after the 5th > column of matrix m. > _________________________________________________________________ > [[elided Hotmail spam]] > > [[alternative HTML version deleted]] > > ______________________________________________ > R-help@r-project.org mailing list > https://stat.ethz.ch/mailman/listinfo/r-help > PLEASE do read the posting guide > http://www.R-project.org/posting-guide.html > and provide commented, minimal, self-contained, reproducible code. >-- Henrique Dallazuanna Curitiba-Paraná-Brasil 25° 25' 40" S 49° 16' 22" O [[alternative HTML version deleted]]
just cbind the cols in the appropriate order: m.2 = cbind( m.1[,1:5], yourthreecolumns, m.1[,6:ncol(m.1)] ) on 06/24/2008 07:02 AM Daren Tan said the following:> Instead of prepend or append new columns to a matrix, how to insert them to a matrix ? For example, I would like to insert 3 new columns after the 5th column of matrix m. > _________________________________________________________________ > [[elided Hotmail spam]] > > [[alternative HTML version deleted]] > > ______________________________________________ > R-help at r-project.org mailing list > https://stat.ethz.ch/mailman/listinfo/r-help > PLEASE do read the posting guide http://www.R-project.org/posting-guide.html > and provide commented, minimal, self-contained, reproducible code. >
Apparently Analagous Threads
- Identifying common prefixes from a vector of words, and delete those prefixes
- How to force aggregate to exclude NA ?
- Any simple way to subset a vector of strings that do contain a particular substring ?
- counting number of "G" in "TCGGGGGACAATCGGTAACCCGTCT"
- Beautify R scripts in microsoft word