similar to: insert new columns to a matrix

Displaying 20 results from an estimated 10000 matches similar to: "insert new columns to a matrix"

2008 Jul 31
4
Identifying common prefixes from a vector of words, and delete those prefixes
For example, c("dog.is.an.animal", "cat.is.an.animal", "rat.is.an.animal"). How can I identify the common prefix is ".is.an.animal" and delete it to give c("dog", "cat", "rat") ? Thanks _________________________________________________________________ [[alternative HTML version deleted]]
2008 Dec 07
5
How to force aggregate to exclude NA ?
The aggregate function does "almost" all that I need to summarize a datasets, except that I can't specify exclusion of NAs without a little bit of hassle. > set.seed(143) > m <- data.frame(A=sample(LETTERS[1:5], 20, T), B=sample(LETTERS[1:10], 20, T), C=sample(c(NA, 1:4), 20, T), D=sample(c(NA,1:4), 20, T)) > m A B C D 1 E I 1 NA 2 A C NA NA 3 D I NA 3 4 C I
2008 Jun 19
4
Any simple way to subset a vector of strings that do contain a particular substring ?
For example, strings <- c("aaaa", "bbbb","ccba"). How to get "aaaa", "bbbb" that do not contain "ba" ? _________________________________________________________________ [[alternative HTML version deleted]]
2008 Jul 15
5
counting number of "G" in "TCGGGGGACAATCGGTAACCCGTCT"
Any better solution than this ? sum(strsplit("TCGGGGGACAATCGGTAACCCGTCT", "")[[1]] == "G") _________________________________________________________________ [[alternative HTML version deleted]]
2008 Sep 13
3
Beautify R scripts in microsoft word
I am generating a report containing several R scripts in the appendix. Is there any way to "beautify" the R source codes in microsoft word, similar to what we see in tinn-R ? Thanks _________________________________________________________________ [[alternative HTML version deleted]]
2008 Jul 08
4
Can R do this ?
I have a folder full of pngs and jpgs, and would like to consolidate them into a pdf with appropriate title and labels. Can this be done via R ? _________________________________________________________________ Easily publish your photos to your Spaces with Photo Gallery. [[alternative HTML version deleted]]
2009 Jan 06
2
Generating GUI for r-scripts
Hi, I have developed some scripts that basically ask for input tab-limited format files, do some processing, and output several pictures or csv. Now I need to have some gui to wrap on top of the scripts, so that end-users can select their input files, adjust some parameters for processing, and select output folder or filenames. Please advice me if there is any tools or project suitable for
2008 Jul 03
1
how to capture matching words in a string ?
I need to capture matching words in a string, any ideas ? I tried using gregexpr, but it was no help. In this example, I need to capture ID23423424 and ID324234325 > s <- "sID23423424 apple pID324234325 orange"> gregexpr("ID[0-9]+", s)[[1]][1] 2 20attr(,"match.length")[1] 10 11 _________________________________________________________________
2008 Jun 23
2
grouping values
I tried aggregate, apply etc, but can't get the right result. For example, m <- cbind(c(LETTERS[1:5]), c("aa", "bb", "cc", "aa", "cc")) [,1] [,2][1,] "A" "aa"[2,] "B" "bb"[3,] "C" "cc"[4,] "D" "aa"[5,] "E" "cc" how to obtain
2008 Oct 30
2
how to convert data from long to wide format ?
Given a dataframe m > m X Y V3 V4 1 1 A 0.5 1.2 2 1 B 0.2 1.4 3 2 A 0.1 0.9 How do I convert m to this with V4 as the cell values ? A B 1 1.2 1.4 2 0.9 NA
2008 Jun 25
3
selecting values that are unique, instead of selecting unique values
unique(c(1:10,1)) gives 1:10 (i.e. unique values), is there any method to get only 2:10 (i.e. values that are unique) ? _________________________________________________________________ Easily edit your photos like a pro with Photo Gallery. [[alternative HTML version deleted]]
2008 Dec 03
2
Speeding up casting a dataframe from long to wide format
Hi, I am casting a dataframe from long to wide format. The same codes that works for a smaller dataframe would take a long time (more than two hours and still running) for a longer dataframe of 2495227 rows and ten different predictors. How to make it more efficient ? wer <- data.frame(Name=c(1:5, 4:5), Type=c(letters[1:5], letters[4:5]), Predictor=c("A", "A",
2008 Nov 26
2
Very slow: using double apply and cor.test to compute correlation p.values for 2 matrices
My two matrices are roughly the sizes of m1 and m2. I tried using two apply and cor.test to compute the correlation p.values. More than an hour, and the codes are still running. Please help to make it more efficient. m1 <- matrix(rnorm(100000), ncol=100) m2 <- matrix(rnorm(10000000), ncol=100) cor.pvalues <- apply(m1, 1, function(x) { apply(m2, 1, function(y) { cor.test(x,y)$p.value
2008 Jun 10
2
Fast method to compute average values of duplicated IDs
Hi, How do I collapse (average in the simplest case) the values of those duplicated ids (i.e., 2, 5, 6, 9) to give a table of unique ids ? t <- cbind(id=c(1:10, 2,5,6,9), value=rnorm(14)) _________________________________________________________________ [[alternative HTML version deleted]]
2008 Jul 14
1
Computing row means for sets of 2 columns
Is there a better or more efficent approach than this without the use of t() ? > (m <- matrix(1:40, ncol=4)) [,1] [,2] [,3] [,4] [1,] 1 11 21 31 [2,] 2 12 22 32 [3,] 3 13 23 33 [4,] 4 14 24 34 [5,] 5 15 25 35 [6,] 6 16 26 36 [7,] 7 17 27 37 [8,] 8 18 28 38 [9,] 9 19 29 39[10,] 10 20 30 40 >
2008 Jun 18
1
operations on all pairs of columns from two matrices
m1 <- matrix(rnorm(40), ncol=4) m2 <- matrix(rnorm(40), ncol=4) I would like to subtract first column of m1 from all columns of m2, subtract 2nd of m1 from all columns of m2, and so on. Obviously, I am not using the appropriate function outer(m1, m1, "-"), since the first column isn't all 0s. _________________________________________________________________
2008 Jul 03
1
Processing 10^8 rows and 1^3 columns
With smaller tab-limited files, I could load them using read.table and the likes. Now I have a gigantic 10^8 rows and 1^3 columns tab-limited file for processsing, please throw some ideas how to handle it. Thanks _________________________________________________________________ Publish your photos to your Space easily with Photo Gallery. [[alternative HTML version deleted]]
2008 Jul 25
2
How to preserve the numeric format and digits ?
Instead of > m <- c(400000000, 50000000000) > paste("A", m, "B", sep="") [1] "A4e+08B" "A5e+10B" I want "A400000000" and "A50000000000"
2008 Nov 04
2
Prevent read.table from converting "+" and "-" to 0
I am using read.table("data.txt", sep="\t") to read in a tab-limited text file. However, two columns of data were read wrongly. read.table converts "+" and "-" in the two columns to 0. I have tried setting other parameters but to no avail. TIA _________________________________________________________________ Get in touch with your inner athlete. Take the
2008 Dec 04
2
How to optimize this codes ?
How to optimize the for-loop to be reasonably fast for sample.size=100000000 ? You may want to change sample.size=1000 to have an idea what I am achieving. set.seed(143) A <- matrix(sample(0:1, sample.size, TRUE), ncol=10, dimnames=list(NULL, LETTERS[1:10])) B <- list() for(i in 1:10) { B[[i]] <- apply(combn(LETTERS[1:10], i), 2, function(x) { sum(apply(data.frame(A[,x]), 1,