search for: matchprob

I run R 1.9.0 on windows 2000, and have the following libraries installed: affydata_1.3.1 affy_1.4.23 Biobase_1.4.10 DynDoc_1.3.14 gcrma_1.0.6 hgu133acdf_1.4.3 hgu95av2cdf_1.4.3 hgu95av2probe_1.0 matchprobes_1.0.7 moe430acdf_1.4.3 multcomp_0.4-6 mvtnorm_0.6-6 rae230acdf_1.4.3 reposTools_1.3.29 rgu34acdf_1.4.3 tkWidgets_1.5.1 widgetTools_1.2.7 1. The rma function (in affy library) always crashes. 2. When executing the sample code in gcrma function's document, the following error occures: Loading...

...filters to analyse one specie or another. I'm using the makeProbePackage available in the AnnotationDbi (for a R-2.13.0) but I got the following error message: Error in rep(NA, max(pm1, mm1, pm2, mm2)) : invalid 'times' argument I already tried an old version of R-2.9.1 with a package matchprobes (that is no longer update for R-2.13.0) but the same error occurs. Does anyone knows how could I overcome this problem? Thank you very much for your attention. Best Regards, Helga -- Helga Garcia PhD student Applied and Environmental Mycology Lab/Molecular Thermodynamics Lab ITQB I - UNL P...

Hello, Im trying to combine 3 affybatches (1x hgu133+2 array and 2x hgu133a array) Im useing this script: library(matchprobes) library(affy) library(AnnotationDbi) library(hgu133plus2probe) library(hgu133aprobe) library(hgu133a.db) u133p2 = ReadAffy() # reading hgu133 +2 cel file into affybatch u133a1 = ReadAffy() # reading hgu133a cel file into affybatch u133a2 = ReadAffy() # reading hgu133a cel file into affybatch d...

...ot; "annaffy" "annotate" [6] "Biobase" "Biostrings" "DynDoc" "gcrma" "genefilter" [11] "geneplotter" "hgu95av2.db" "limma" "marray" "matchprobes" [16] "multtest" "ROC" "vsn" "xtable" "affyQCReport" Anything that I install after this gives me the same error. I tried uninstalling R 2.7.0 and installing R 2.6.2, and performing the same commands, as above,...

I have encountered an issue while preparing some of the Bioconductor packages for our upcoming release, and Duncan Murdoch suggested that I bring one of the related points up here. The background is that we are building our packages under Windows with "Rcmd install --build" which will flag the zip options. When the total size of files in <pkg>\data are over a certain threshold of

Any better solution than this ? sum(strsplit("TCGGGGGACAATCGGTAACCCGTCT", "")[[1]] == "G") _________________________________________________________________ [[alternative HTML version deleted]]

...[7] "tools" "methods" "base" other attached packages: multtest rat2302cdf affycoretools annaffy xtable "1.13.1" "1.15.0" "1.7.8" "1.7.3" "1.4-3" gcrma matchprobes biomaRt RCurl XML "2.7.3" "1.7.4" "1.9.21" "0.8-0" "1.6-0" GOstats Category Matrix lattice genefilter "2.1.13" "2.1.20" "0.9975...

...[7] "tools" "methods" "base" other attached packages: multtest rat2302cdf affycoretools annaffy xtable "1.13.1" "1.15.0" "1.7.8" "1.7.3" "1.4-3" gcrma matchprobes biomaRt RCurl XML "2.7.3" "1.7.4" "1.9.21" "0.8-0" "1.6-0" GOstats Category Matrix lattice genefilter "2.1.13" "2.1.20" "0.9975...

...ith 'help(Biobase)'. > > For details on reading vignettes, see the openVignette help page. > > >Loading required package: affyio >Loading required package: affydata >Loading required package: Biobase >Loading required package: gcrma >Loading required package: matchprobes >Loading required package: reposTools >Loading required package: simpleaffy >Loading required package: genefilter >Loading required package: survival >Loading required package: splines >Welcome to 'affyQCReport' V 1.6-1 >Further information available at: www.bifix.org...

...} else { stuProbs[,i] <- pCorr(correctClsMat, correctStuMat[i], q = length(key)) } } stuProbs[which(is.na(dat))] <- NA # this is a bit kludgy. But, it places NAs in the right place matchProb <- function(StuMat, wrongMat, numItems){ ind <- combn(c(1:ncol(StuMat)),2) # These are all the possible combinations result <- matrix(0, ncol=ncol(ind), nrow=numItems) for(j in 1:ncol(ind)){ for(i in 1:numItems...

...ngle channel normalization, support for import of exprSet and marrayNorm data objects, improved support for design and contrast matrices, new fitted model object class, within-gene multiple testing, Venn diagrams and generally a move to a simpler command style at the user level. --- matchprobes: A new package providing tools for working with probe sequence information: calculate ATCG content, reverse, complement, mismatch sequences; fast exact sequence matching; combine AffyBatches of different chip types; create probe data packages. --- Measurement.cor: A package to...

...ngle channel normalization, support for import of exprSet and marrayNorm data objects, improved support for design and contrast matrices, new fitted model object class, within-gene multiple testing, Venn diagrams and generally a move to a simpler command style at the user level. --- matchprobes: A new package providing tools for working with probe sequence information: calculate ATCG content, reverse, complement, mismatch sequences; fast exact sequence matching; combine AffyBatches of different chip types; create probe data packages. --- Measurement.cor: A package to...

...[7] "tools" "methods" "base" other attached packages: multtest rat2302cdf affycoretools annaffy xtable "1.13.1" "1.15.0" "1.7.8" "1.7.3" "1.4-3" gcrma matchprobes biomaRt RCurl XML "2.7.3" "1.7.4" "1.9.21" "0.8-0" "1.6-0" GOstats Category Matrix lattice genefilter "2.1.13" "2.1.20" "0.9975...

An embedded and charset-unspecified text was scrubbed... Name: ?????? ?? ????????. URL: <https://stat.ethz.ch/pipermail/r-help/attachments/20080818/dcaa0623/attachment.pl>

...croarray Data makecdfenv CDF Environment Maker MAQCsubset Experimental Data Package: MAQCsubset marray Exploratory analysis for two-color spotted microarray data MASS Main Package of Venables and Ripley's MASS matchprobes Tools for sequence matching of probes on arrays Matrix A Matrix package for R methods Formal Methods and Classes mgcv GAMs with GCV smoothness estimation and GAMMs by REML/PQL MLInterfaces Uniform i...

..." "methods" "base" other attached packages: made4 scatterplot3d ade4 affycoretools annaffy "1.8.0" "0.3-24" "1.4-2" "1.7.5" "1.6.1" xtable gcrma matchprobes biomaRt RCurl "1.4-3" "2.6.0" "1.6.0" "1.8.1" "0.8-0" XML GOstats Category genefilter survival "1.4-0" "2.0.4" "2.0.3"...

...ages(pkgs = pkgs, repos = repos, dependencies = >> dependencies, ... : >> installation of package 'Biostrings' had non-zero exit status >> 7: In install.packages(pkgs = pkgs, repos = repos, dependencies = >> dependencies, ... : >> installation of package 'matchprobes' had non-zero exit status >> 8: In install.packages(pkgs = pkgs, repos = repos, dependencies = >> dependencies, ... : >> installation of package 'vsn' had non-zero exit status >> 9: In install.packages(pkgs = pkgs, repos = repos, dependencies = >> depend...

I have recently upgraded to Ubuntu Gutsy and, for the first time, am using a 64-bit installation. After failing miserably to install R from source, not a problem for me in the past with a 32-bit install, I went the route of using the Debian Etch build. This went smoothly, but I am unable to update my numerous R and BioConductor packages, getting non-zero exit status errors on each package. Is