search for: matchprobes

I run R 1.9.0 on windows 2000, and have the following libraries installed: affydata_1.3.1 affy_1.4.23 Biobase_1.4.10 DynDoc_1.3.14 gcrma_1.0.6 hgu133acdf_1.4.3 hgu95av2cdf_1.4.3 hgu95av2probe_1.0 matchprobes_1.0.7 moe430acdf_1.4.3 multcomp_0.4-6 mvtnorm_0.6-6 rae230acdf_1.4.3 reposTools_1.3.29 rgu34acdf_1.4.3 tkWidgets_1.5.1 widgetTools_1.2.7 1. The rma function (in affy library) always crashes. 2. When executing the sample code in gcrma function's document, the following error occures: Loading r...

...filters to analyse one specie or another. I'm using the makeProbePackage available in the AnnotationDbi (for a R-2.13.0) but I got the following error message: Error in rep(NA, max(pm1, mm1, pm2, mm2)) : invalid 'times' argument I already tried an old version of R-2.9.1 with a package matchprobes (that is no longer update for R-2.13.0) but the same error occurs. Does anyone knows how could I overcome this problem? Thank you very much for your attention. Best Regards, Helga -- Helga Garcia PhD student Applied and Environmental Mycology Lab/Molecular Thermodynamics Lab ITQB I - UNL Por...

Hello, Im trying to combine 3 affybatches (1x hgu133+2 array and 2x hgu133a array) Im useing this script: library(matchprobes) library(affy) library(AnnotationDbi) library(hgu133plus2probe) library(hgu133aprobe) library(hgu133a.db) u133p2 = ReadAffy() # reading hgu133 +2 cel file into affybatch u133a1 = ReadAffy() # reading hgu133a cel file into affybatch u133a2 = ReadAffy() # reading hgu133a cel file into affybatch dat...

...ot; "annaffy" "annotate" [6] "Biobase" "Biostrings" "DynDoc" "gcrma" "genefilter" [11] "geneplotter" "hgu95av2.db" "limma" "marray" "matchprobes" [16] "multtest" "ROC" "vsn" "xtable" "affyQCReport" Anything that I install after this gives me the same error. I tried uninstalling R 2.7.0 and installing R 2.6.2, and performing the same commands, as above, bu...

I have encountered an issue while preparing some of the Bioconductor packages for our upcoming release, and Duncan Murdoch suggested that I bring one of the related points up here. The background is that we are building our packages under Windows with "Rcmd install --build" which will flag the zip options. When the total size of files in <pkg>\data are over a certain threshold of

Any better solution than this ? sum(strsplit("TCGGGGGACAATCGGTAACCCGTCT", "")[[1]] == "G") _________________________________________________________________ [[alternative HTML version deleted]]

...[7] "tools" "methods" "base" other attached packages: multtest rat2302cdf affycoretools annaffy xtable "1.13.1" "1.15.0" "1.7.8" "1.7.3" "1.4-3" gcrma matchprobes biomaRt RCurl XML "2.7.3" "1.7.4" "1.9.21" "0.8-0" "1.6-0" GOstats Category Matrix lattice genefilter "2.1.13" "2.1.20" "0.9975-1...

...[7] "tools" "methods" "base" other attached packages: multtest rat2302cdf affycoretools annaffy xtable "1.13.1" "1.15.0" "1.7.8" "1.7.3" "1.4-3" gcrma matchprobes biomaRt RCurl XML "2.7.3" "1.7.4" "1.9.21" "0.8-0" "1.6-0" GOstats Category Matrix lattice genefilter "2.1.13" "2.1.20" "0.9975-1...

...ith 'help(Biobase)'. > > For details on reading vignettes, see the openVignette help page. > > >Loading required package: affyio >Loading required package: affydata >Loading required package: Biobase >Loading required package: gcrma >Loading required package: matchprobes >Loading required package: reposTools >Loading required package: simpleaffy >Loading required package: genefilter >Loading required package: survival >Loading required package: splines >Welcome to 'affyQCReport' V 1.6-1 >Further information available at: www.bifix.org &...

While building a package, I see the following: * checking R code for possible problems ... NOTE cheat.fit: no visible binding for global variable 'Zobs' plot.jml: no visible binding for global variable 'Var1' I see the issue has come up before, but I'm having a hard time discerning how solutions applied elsewhere would apply here. The entire code for both functions is below,

...ngle channel normalization, support for import of exprSet and marrayNorm data objects, improved support for design and contrast matrices, new fitted model object class, within-gene multiple testing, Venn diagrams and generally a move to a simpler command style at the user level. --- matchprobes: A new package providing tools for working with probe sequence information: calculate ATCG content, reverse, complement, mismatch sequences; fast exact sequence matching; combine AffyBatches of different chip types; create probe data packages. --- Measurement.cor: A package to f...

...ngle channel normalization, support for import of exprSet and marrayNorm data objects, improved support for design and contrast matrices, new fitted model object class, within-gene multiple testing, Venn diagrams and generally a move to a simpler command style at the user level. --- matchprobes: A new package providing tools for working with probe sequence information: calculate ATCG content, reverse, complement, mismatch sequences; fast exact sequence matching; combine AffyBatches of different chip types; create probe data packages. --- Measurement.cor: A package to f...

...[7] "tools" "methods" "base" other attached packages: multtest rat2302cdf affycoretools annaffy xtable "1.13.1" "1.15.0" "1.7.8" "1.7.3" "1.4-3" gcrma matchprobes biomaRt RCurl XML "2.7.3" "1.7.4" "1.9.21" "0.8-0" "1.6-0" GOstats Category Matrix lattice genefilter "2.1.13" "2.1.20" "0.9975-1...

An embedded and charset-unspecified text was scrubbed... Name: ?????? ?? ????????. URL: <https://stat.ethz.ch/pipermail/r-help/attachments/20080818/dcaa0623/attachment.pl>

...croarray Data makecdfenv CDF Environment Maker MAQCsubset Experimental Data Package: MAQCsubset marray Exploratory analysis for two-color spotted microarray data MASS Main Package of Venables and Ripley's MASS matchprobes Tools for sequence matching of probes on arrays Matrix A Matrix package for R methods Formal Methods and Classes mgcv GAMs with GCV smoothness estimation and GAMMs by REML/PQL MLInterfaces Uniform int...

..." "methods" "base" other attached packages: made4 scatterplot3d ade4 affycoretools annaffy "1.8.0" "0.3-24" "1.4-2" "1.7.5" "1.6.1" xtable gcrma matchprobes biomaRt RCurl "1.4-3" "2.6.0" "1.6.0" "1.8.1" "0.8-0" XML GOstats Category genefilter survival "1.4-0" "2.0.4" "2.0.3" &...

...ages(pkgs = pkgs, repos = repos, dependencies = >> dependencies, ... : >> installation of package 'Biostrings' had non-zero exit status >> 7: In install.packages(pkgs = pkgs, repos = repos, dependencies = >> dependencies, ... : >> installation of package 'matchprobes' had non-zero exit status >> 8: In install.packages(pkgs = pkgs, repos = repos, dependencies = >> dependencies, ... : >> installation of package 'vsn' had non-zero exit status >> 9: In install.packages(pkgs = pkgs, repos = repos, dependencies = >> dependen...

I have recently upgraded to Ubuntu Gutsy and, for the first time, am using a 64-bit installation. After failing miserably to install R from source, not a problem for me in the past with a 32-bit install, I went the route of using the Debian Etch build. This went smoothly, but I am unable to update my numerous R and BioConductor packages, getting non-zero exit status errors on each package. Is