R help - Sep 2011 - merging nexus sequence files

Hi, newbie here,

I was wondering if anyone can out, I have checked through the help archives
but cannot find my answer.

I have three nexus files mostly with the same taxa but some are different. I
want to concatenate the DNA sequences from these three files into one large
nexus file but I cannot seem to accomplish it!

This is an example:

file1
taxon1 aaggttcc
taxon2 aagtttcg
taxon3 aaggttcc

file2
taxon2 ctgctg
taxon3 ctggtc
taxon4 ctgctg

file3
taxon1 ggttggtta
taxon2 ggttggttc
taxon4 ggttggttc

this is what i want to end up with (where ? means missing data) in nexus
format:

taxon1 aaggttcc??????ggttggtta
taxon2 aagtttcgctgctgggttggttc
taxon3 aaggttccctggtc????????
taxon4 ??????????????ggttggttc

Thanks in advance for any help!


--
View this message in context:
http://r.789695.n4.nabble.com/merging-nexus-sequence-files-tp3816907p3816907.html
Sent from the R help mailing list archive at Nabble.com.

On Sep 15, 2011, at 6:00 PM, nikki22 wrote:
> Hi, newbie here,
>
> I was wondering if anyone can out, I have checked through the help  
> archives
> but cannot find my answer.
>
> I have three nexus files mostly with the same taxa but some are  
> different. I
> want to concatenate the DNA sequences from these three files into  
> one large
> nexus file but I cannot seem to accomplish it!
>
> This is an example:
>
> file1
> taxon1 aaggttcc
> taxon2 aagtttcg
> taxon3 aaggttcc
>
> file2
> taxon2 ctgctg
> taxon3 ctggtc
> taxon4 ctgctg
>
> file3
> taxon1 ggttggtta
> taxon2 ggttggttc
> taxon4 ggttggttc

dat.mrg <- merge(
              merge(file1,file2, by="V1", all=TRUE),
              file3,
               by="V1", all=TRUE)

 > dat.mrg$pseqs <- with(dat.mrg, paste(V2.x ,  V2.y  ,      V2,  
sep=""))
 > dat.mrg$pseqs <- gsub("NA", "??????",
dat.mrg$pseqs)
 >  dat.mrg[ , c(1,5)]
       V1                   pseqs
1 taxon1 aaggttcc??????ggttggtta
2 taxon2 aagtttcgctgctgggttggttc
3 taxon3    aaggttccctggtc??????
4 taxon4   ??????ctgctgggttggttc
>
> this is what i want to end up with (where ? means missing data) in  
> nexus
> format:
>
> taxon1 aaggttcc??????ggttggtta
> taxon2 aagtttcgctgctgggttggttc
> taxon3 aaggttccctggtc????????
> taxon4 ??????????????ggttggttc
>
> Thanks in advance for any help!
>
>

David Winsemius, MD
West Hartford, CT