similar to: coxph in R

Displaying 20 results from an estimated 1300 matches similar to: "coxph in R"

2013 Oct 29
3
Ayuda con Mice con polyreg
Saludo gente, antes que nada gracias por la ayuda que puedan aportarme, soy iniciante en R, estoy usando el paquete Mice para realizar imputaciones múltiples sobre variables en su mayoría categóricas. El problema está que cuando expresó este comando imp <- mice(dataset,method="polr",maxit=1) donde el dataset es un data.frame me tirá este error : iter imp variable 1 1 pial1a
2013 Oct 30
1
Material y videos disponibles - Reunión del "Grupo de Usuarios de R de Madrid - martes 29-octubre"....
Saludo a todos, una consulta, donde hay que enviar las dudas en R para que alguién con mayor conocimiento en R nos ayude!!, Me llegan estos email lo cual son interesantes pero necesito ayuda!. Por favor!, gracias. El 30 de octubre de 2013 10:16, Felipe Vargas Reeve <kaiser756@gmail.com>escribió: > Muy buena iniciativa y gestión Carlos, se agradece. Saludos estimado, > atte >
2012 Feb 29
1
codon usage bias
Hey guys, I have what i think is a really simple problem :( I installed the seqinr library. I want to do an RSCU analysis. But i can't get it to work in even the simplest case. for example, if i have a string read in: > newdata5 $testseq [1] "agtgagatgatagatagatagatagatagatagatagaccccccagata" and then i perform an RSCU analysis on it... >
2006 Nov 17
1
gjournal on 6.x wont build
Hi all, I was intending on trying out gjournal on a new disk i've added in my desktop. I had a look to see what the most recent patch provided by Pawel and found http://people.freebsd.org/~pjd/patches/gjournal6_20061024.patch I created the directories as per Pawel's original post (http://lists.freebsd.org/pipermail/freebsd-fs/2006-June/001962.html) and the patch succeeded with no failed
2007 Jul 28
0
request for info - X on an IBM
I can install xen fine on this laptop. trouble is that I have no output from terminals or X when I use Fedora based distros. Has anything changed in relation to this bug? I''d rather stick to this list to avoid cross or double posting but do tell me if this is the correct list or not. [https://launchpad.net/distros/fedora/+bug/74023] Here''s the output of lspci:- /sbin/lspci -v
2006 Feb 02
1
Conflict between julian from base and from chron
I used to run the julian function from chron but this new version of R has also a julian function in the base package that doesn't do exactly what I need. Is there a way of telling R to run the function from chron and not from base? Thanks, Fernando __________________________ Fernando Colchero Doctoral Fellow Duke University Department of Ecology
2012 Jun 21
1
install package mixdist
Hi all, I'm trying to install the mixdist package with: install.packages("mixdist") But I'm getting the following errors: * installing *source* package ‘mixdist’ ... ** R ** data ** preparing package for lazy loading ** help *** installing help indices ** building package indices ... Warning in utils::data(list = f, package = package, lib.loc = lib.loc, envir = dataEnv) :
2004 Nov 13
13
shorewall.net is back
-----BEGIN PGP SIGNED MESSAGE----- Hash: SHA1 The server rebuild was a complete failure. For some reason, neither FC3 nor SuSE 9.2 like the graphics card in the box. I have reinstalled the old hard drive and the server is back on line. - -Tom - -- Tom Eastep \ Nothing is foolproof to a sufficiently talented fool Shoreline, \ http://shorewall.net Washington USA \ teastep@shorewall.net
2011 Jun 28
2
coxph() - unexpected result using Crawley's seedlings data (The R Book)
Hi, I ran the example on pp. 799-800 from Machael Crawley's "The R Book" using package survival v. 2.36-5, R 2.13.0 and RStudio 0.94.83. The model is a Cox's Proportional Hazards model. The result was quite different compared to the R Book. I have compared my code to the code in the book but can not find any differences in the function call. My results are attached as well as a
2005 Aug 04
1
HELP! X100P IRQ conflict w/ USB
PC: HP Vetra VL400 Mainbood: Intel815 BIOS: Phonix 4.0 release 6.0 OS: REDHAT 9.0 I installed the X100P in PCI slot 2 and disable the USB port, serial-port and parallel-port in BIOS. I can't found the X100P card in " cat interrupts" But I can found the card in the "cat ioports" use "lspci" I found the X100Pcard use the interrupts 11 too. Who can help me to solve
2003 Jul 14
2
insmod wcfxo failed ( b8zs, esf, wink start is what I'm trying to do.)
Thanks in advance root@asterisk01:~# modprobe wcfxo /lib/modules/2.4.20/misc/wcfxo.o: init_module: No such device /lib/modules/2.4.20/misc/wcfxo.o: Hint: insmod errors can be caused by incorrect module parameters, including invalid IO or IRQ parameters. You may find more information in syslog or the output from dmesg /lib/modules/2.4.20/misc/wcfxo.o: insmod /lib/modules/2.4.20/misc/wcfxo.o
2008 May 07
1
coxph - weights- robust SE
Hi, I am using coxph with weights to represent sampling fraction of subjects. Our simulation results show that the robust SE of beta systematically under-estimate the empirical SD of beta. Does anyone know how the robust SE are estimated in coxph using weights? Is there any analytical formula for the “weighted” robust SE? Any help is appreciated! Thanks so much in advance Willy
2007 Oct 25
1
PR#10371
Oops -- I should have tested it without libraries loaded :-) The conflict must be with the HH package. I tested the example again using all the packages required by HH and do get the correct results, but once the HH package is loaded, the TukeyHSD function returns "height" and the plot command gives the error described previously. Should I report this bug directly to the authors of
2002 Dec 05
1
is.loaded("gamma") is FALSE in Windows
Hi! I am working on dynamically loading some C code into R and have my programs working on a DEC alpha. I have tried porting it to windows and found that the gamma function is not loaded in the symbol table there, but is under unix. While I can add in the gamma function, I would prefer to use the same one as in R and have the same code under unix and wondows. Is there a way to access the
2008 Feb 27
3
Values are multiplied by 100x
Hi, I type a value, for example, "10,00". I see in the screen "10,00" but when print that value is multiplied by 100x resulting: "1000,00". What can I do? wine 0.9.55-1 Debian/Sid Thanks. -- S?vio M Ramos Arquiteto, Rio, RJ S? uso Linux desde 2000 www.debian.org
2007 Feb 24
0
Wildcard Testing
Greetings and I thank you in-advance, I have a system installed with both Trixbox 1.x and 2.x installed and I am trying to utilize a wildcard x100p but it does seem hang-up or release the line. I understand that the Wildcards are not recommended, but I need to get a test system up for evaluation. Here are the steps followed: Run genzaptelconf and red alarm appears in zttool Run again and it
2013 Oct 29
0
Fwd: Ayuda con Mice con polyreg
Saludo gente, antes que nada gracias por la ayuda que puedan aportarme, soy iniciante en R, estoy usando el paquete Mice para realizar imputaciones múltiples sobre variables en su mayoría categóricas. El problema está que cuando expresó este comando imp <- mice(dataset,method="polr",maxit=1) donde el dataset es un data.frame me tirá este error : iter imp variable 1 1 pial1a
2009 Aug 31
0
source(.trPaths[5], echo=TRUE, max.deparse.length=150)
I just upgraded to Tinn-R 2.3.2.3. Is the above line (see Subject) going to be echoed back to me everytime I try to send a command to R of can I stop it? I've also lost my function of arrowing back up to recall previous commands. Can I get that back? richard -- Richard M. Anderson, Assistant Professor Duke University, Nicholas School of the Environment A321 LSRC Box 90328 Durham, NC
2006 Jun 14
0
FW: Issue in configuring TDM400P
Hi, I have installed a TDM400P in a PC which runs RedHat Linux 3.2.2-5. There is an FXS module connected to the first slot of TDM400P and an FXO module connected to the fourth slot. This card is detected by the operationg system, which I was able to make sure using the output of lspci command. I modified the configuration files zaptel.conf, zapata.conf and extensions.conf. When I execute the
2006 Feb 14
4
Good VoIP providers that support Asterisk PBX's
Hi Folks, Can anyone give me some good recommendations for VoIP providrs that support Asterisk PBX's? We're based in Georgia and I having a hard time finding anyone.... Regards, Jim PS - If you could CC me in on the reply I would greatly appreciate it! jim(-A T-)linux-sp.com