search for: againg

Displaying 20 results from an estimated 33 matches for "againg".

Did you mean: again
2007 Apr 18
0
Yours - may T0m invest Sara 's market
AGA Resources Climbs 33% after announcing the Acquisition Of Triumph Research LTD and Beijing Tangde International Film and Culture Co. LTD This is climbing move now. AGA Resources Inc. A G A 0 Open: $2.25 Close: $3.00 Up: 33% AGA announced its Acquisition of a B.V.I. company to become involved in a Media and Entertainment Joint Venture in China. This agreement gives them controlling shares of
2007 Apr 18
0
Yours - may T0m invest Sara 's market
AGA Resources Climbs 33% after announcing the Acquisition Of Triumph Research LTD and Beijing Tangde International Film and Culture Co. LTD This is climbing move now. AGA Resources Inc. A G A 0 Open: $2.25 Close: $3.00 Up: 33% AGA announced its Acquisition of a B.V.I. company to become involved in a Media and Entertainment Joint Venture in China. This agreement gives them controlling shares of
2004 Feb 06
1
How to get the pseudo left inverse of a singular squarem atrix?
>I'm rusty, but not *that* rusty here, I hope. > >If W (=Z*Z' in your case) is singular, it can not have >inverse, which by >definition also mean that nothing multiply by it will >produce the identity >matrix (for otherwise it would have an inverse and >thus nonsingular). > >The definition of a generalized inverse is something >like: If A is a >non-null
2013 Jul 23
1
Heat Map for species - code from Numerical Ecology with R
Hello, I am relatively new to R and I am working through the code that is provided in the book Numerical Ecology with R and I have run across an error message that I can't seem to figure out. I am using the vegan, ade4, gclus and cluster packages. The code is as follows: # Ordered community table # Species are ordered by their weighted averages on site scores or <- vegemite(spe,
2003 Jun 22
4
Is this possible:
The hardware we are planning to use is: Micronet SP5050 FXO Gateway http://www.micronet.com.tw/Products/VoIP/SP5050.asp Micronet SP5100 IP Phone http://www.micronet.com.tw/Products/VoIP/SP5100.asp We are hoping to use this hardware along with AsteriskPBX to replace our aging PBX system. What I want to acheive is: * Any incoming call from PSTN (via gateway) rings on the receptionists phone for
2006 Feb 19
2
Can someone help plss
Hi frends, I'm trying to use icecast for the first time i never have been using this or another webradio stuff. My question is when i'm in the edit configuration i don't know where i can set the source in wich i can let listen mp3's with my winamp player i have connection but there is no music playing i want to let listen music with my winamp. Please can some of you write me how i
2005 May 15
1
Re: SpanDSP TXFax and multipage faxes problems (aditional info)
Hi everyone ! I have some aditional info on problem with TXFax and sending multi-page TIFFs. I have made 6 different multi-page TIFFs (Group3 1D with fillbits EOL aligned - 3 pages one TIFF in lowres and one in hires, Group3 2D -3 pages againg in both resolutions , and Group 4 - 3pages in both resolutions), and then tried to send them to Panasonic KX-F1100, Panasonic KX-F500 and SpanDSP RXFax on different Asterisk server then sending one, over POTS. Results are: 1. KX-F1100 always gets first page and if fax is in HIRES it delivers em...
2012 Feb 29
1
codon usage bias
Hey guys, I have what i think is a really simple problem :( I installed the seqinr library. I want to do an RSCU analysis. But i can't get it to work in even the simplest case. for example, if i have a string read in: > newdata5 $testseq [1] "agtgagatgatagatagatagatagatagatagatagaccccccagata" and then i perform an RSCU analysis on it... >
2007 Aug 17
2
Date format on x-axis
Dear R users, Plotting question from a R beginner... When I try to plot a response through time, for example: >Date<-c("2006-08-17", "2006-08-18", "2006-08-19", "2006-08-20") >response<-c(4,4,8,12) >as.Date(Date) >plot(Date,response) The dates on the graphic appear in spanish. This I guess is the default way of plotting because my
2006 May 28
10
Drag''n''Drop out of overflow:auto containers
Cheers, I have some elements inside a div with overflow:auto. When I trie to drag them outside of the div, the div starts to scroll. Is there a way to stop this behaviour for drag and drop? I thought of maybe using callback to disable the overflow and restoring it againg after the drop. Did someone implemented something like this? Thanks, Jonathan -- Jonathan Weiss http://blog.innerewut.de
2006 Sep 09
1
PDC config asking for double AUTH
Hy, I have set up a samba PDC with tdbsam, for a office, everything seems to be ok, users logon to the pcs with their user domains, the policies are working ok, but once they login, when they try to access a share in the samba pdc server, it asks againg for user and passwd, Any idea why its doing this?, you cant access also the netlog on share, so no scripts are working :**. Another doubdt i have is if i dont want roaming profiles, i just want to the users to use their profile in their pc how can i do it? my config is like this: #============...
2010 May 11
3
Improving loop performance
R-users, I have the following piece of code which I am trying to run on a dataframe (aga2) with about a half million records.  While the code works, it is extremely slow.  I've read some of the help archives indicating that I should allocate space to the p1 and ags1 vectors, which I have done, but this doesn't seem to improve speed much.  Would anyone be able to provide me with advice on
2004 Apr 08
3
Re: : External access to voicemail
Hello steve. Here is a patch I wrote for app_voicemail.c which does exactly as you describe. When the outgoing message is playing, if the listener hits the "*" key, they're prompted for a mailbox and password, whereupon they can check their voicemail as if they were using the internal phone. I found no other way of doing this. If you patch your app_voicemail.c, I have V1.44 from
2006 Feb 20
0
Can someone help plss
Copying the list on my reply, just in case it helps someone else too. Remzi Aga wrote: > I'll try to write you what i have done. First i installed the ( > icecast2_win32_v2.3.1_setup ) program. > After that i klicked the edit configuration tool and i made some changes in > that text area. The things i changed where only username, password, my > ipadrees and i made the .ogg
2007 Jul 17
1
Not hearing the caller after 2 x Flash
Me again, another problem. As I said before, I have 2 lines going into "incoming" context. When client calls, I press Flash, client hears music on hold (only on voip line as said in previous post), when I get back and press Flash again to get back to my client I cannon hear him, but he hears me without problems. I have just tested in on the LAN, same situations, happens everytime.
2006 Sep 18
0
printer problem
...amba to support about fifteen people, some people use the printer very well, but serveral people have some problem with the share printer. when you add the the printer first time you can print without any question, but it doesn't work the second time, then you delte the printer and add it againg, the same situation happen. so you need delte and add every time when you want print something. did some people have the same question before. Can any one can help me. many thanks yajing _________________________________________________________________ ÏíÓÃÊÀ½çÉÏ×î´óµÄµç×ÓÓʼþϵͳ¡ª MSN Hotmai...
2003 Aug 14
0
How to get the pseudo left inverse of a singular square m atrix?
I'm rusty, but not *that* rusty here, I hope. If W (=Z*Z' in your case) is singular, it can not have inverse, which by definition also mean that nothing multiply by it will produce the identity matrix (for otherwise it would have an inverse and thus nonsingular). The definition of a generalized inverse is something like: If A is a non-null matrix, and G satisfy AGA = A, then G is called
2003 Mar 06
1
[stuart.leask@nottingham.ac.uk: R in your pocket on a Sharp Zaurus]
Ah, but the interesting thing is that they are coming out with a 'clam' version like the 5MX. Details are limited at the moment, but that could mean the combination of 5MX usability with a supported linux distro. I am drooling in anticipation. Sounds like a "I've finally finished my PhD and deserve a treat" situation to me :) Dave On Thu, Mar 06, 2003 at 09:17:20AM
2012 Nov 15
3
Can you have a by variable in Lag function as in SAS
Hello, I want to use lag on a time variable but I have to take date into consideration ie I don't want days to overlap ie: I don't want my first time of today to match my last time of yeterday. In SAS I would use : data x; set y; by date tim; previous=lag(tim); if first.date then do; previous=.; end; run; How can I do something similar in R? I can't find
2002 Jan 06
2
Passing names of variables to functions
Hi, I am still new to R and have a programming question. I have created a small function which takes a parameter. In the function I want to be able to refer to the names of the variables sent to the function (specifically I want to be able to use the name of the variable given to the function in an output table). For example, in the following (fictional) function I want some way of printing