similar to: sliding window approach

Displaying 20 results from an estimated 1000 matches similar to: "sliding window approach"

2007 Jul 18
2
remove columns having a partial match name
Dear all, I would like to know how can I retrieve a data.frame without the columns that have a partial match name. Let´s say that I have a data.frame with 200 columns and 100 of them have the name "StartX", with X being the unique part for each column name. I want to delete all columns that have the name starting with "Start". I´ve tried to do this but it doesn´t work: >
2007 Jul 20
3
binned column in a data.frame
Dear all, I would like to know how can I create a binned column in a data.frame. The output that I would like is something like this: Start Binned_Start 1 0-5 2 0-5 6 5-10 8 5-10 13 10-15 ... Best regards João Fadista Ph.d. student UNIVERSITY OF AARHUS Faculty of Agricultural Sciences Dept. of Genetics and Biotechnology Blichers
2007 May 31
0
distribution of peaks in random data results
Dear all, I have the positions of N points spread through some sequence of length L (L>N), and I would like to know how can do the following: 1- Permute the positions of the N points along the whole sequence. Assuming a uniform distribution I did: position1 <- runif(N, 1, L) 2- Apply a kernel convolution method to the resulting permuted points profile. For this I applied the
2007 Jul 19
0
test about distribution of data in a single population
Dear all, I would like to know how can I test which are the intervals of my data that have significant less or more counts than the other intervals. Example: Interval [1:200] [200:400] [400:600] [600:800] ... more 900 hundred columns Count 12 28 7 5 Thanks in advance, Best regards João Fadista Ph.d.
2008 Apr 08
4
permutation test assumption?
Dear all, Can I do a permutation test if the number of individuals in one group is much bigger than in the other group? I searched the literature but I didin´t find any assumption that refers to this subject for permutation tests. Best regards João Fadista Ph.d. student UNIVERSITY OF AARHUS Faculty of Agricultural Sciences Dept. of Genetics and Biotechnology Blichers Allé 20, P.O.
2007 Mar 30
1
Model comparison
Dear all, I would like to know if I can compare by a significance test 2 models with different kind of parameters. Perhaps I am wrong but I think that we can only compare 2 models if one is a sub model of the other. Med venlig hilsen / Regards João Fadista Ph.d. studerende / Ph.d. student AARHUS UNIVERSITET / UNIVERSITY OF AARHUS Det Jordbrugsvidenskabelige Fakultet / Faculty of
2007 Mar 23
2
concatenate 2 data.frames
Dear all, I would like to know how can I concatenate 2 data.frames into a single one. Both data frames have the same number of columns and the same class type in each correspondent column. So what I want is to have a new data.frame where I have first the values from one data.frame and then the values from a second data.frame would came after in this new data.frame. Thanks in advance. Med
2011 Jun 06
1
Log file of building vignette in RCMD check
Hello, I am trying to run "RCMD check" on a package. It performs OK, with the exception of a single warning: * checking package vignettes in 'inst/doc' ... WARNING Package vignette(s) without corresponding PDF: AnnotationFuncsUserguide.Rnw As I understand the problem, the vignette is not built. However, I have no problems in doing so manually. How do I fix this problem? I
2006 Jan 31
0
lattice: combining panel.xyplot with panel.abline - is thispossible?
Well, one way to do it is xyplot(y~time|id, data=dat,type='l', panel=function(x,y,subscripts,...){ panel.xyplot(x,y,subscripts,...) panel.abline(v=dat[subscripts,"cm1"]) panel.abline(v=dat[subscripts,"cm2"]) } ) Since I don't know what the dataframe 'mergeData' is I have used 'dat'. Best regards Frede Aakmann
2011 Sep 14
4
Reading large, non-tabular files
Dear R-help, I have a very large ascii data file, of which I only want to read in selected lines (e.g. on fourth of the lines); determining which lines depends on the lines content. So far, I have found two approaches for doing this in R; 1) Read the file line by line using a repeat-loop and save the result in a temporary file or a variable, and 2) Read the entire file and filter/reshape it using
2007 Oct 24
2
analytical solution to Sum of binominal distributed random numbers?
Frede Aakmann T?gersen wrote: > Perhaps > > http://stinet.dtic.mil/cgi-bin/GetTRDoc?AD=ADA266969&Location=U2&doc=GetTRDoc.pdf > > is something that you can use? Thanks a lot - that might help. Rainer > > > > Best regards > > Frede Aakmann T?gersen > Scientist > > > UNIVERSITY OF AARHUS > Faculty of Agricultural Sciences > Dept.
2011 Oct 04
2
R-devel (2.14 alpha) Windows binary
Hello, This question popped up on the bioc-devel list, I'm forwarding it here. I know that sources for R-2.14 alpha can be found here: http://cran.r-project.org/src/base-prerelease/ But the OP (below) is asking about Windows binaries. Dan ---------- Forwarded message ---------- From: Stefan McKinnon H?j-Edwards <Stefan.Hoj-Edwards at agrsci.dk> Date: 2011/10/4 Subject: Re:
2004 May 04
2
Seeing the definition of a function
Dear all, I was trying to see how the function 'confint' is defined. Doing > confint function (object, parm, level = 0.95, ...) UseMethod("confint") <environment: namespace:stats> does not really enlighten me. How can I get to see the implementation (I guess it should be possible according to the general philosophy of the R project)? Thanks in advance S??ren
2002 Dec 09
2
R as a COM client - is it possible?
Dear all, In S+, there are functions like create.ole.object call.ole.method release.ole.object for communicating with other programs which work as a COM server (on Windows). Is it possible to do something similar in R (I've studied the 'connections' facilities, but they do not seem to work). ========================================== S?ren H?jsgaard, PhD, Senior Scientist
2004 Feb 24
1
rstandard does not produce standardized residuals
Dear all, the application of the function rstandard() in the base package to a glm object does not produce residuals standardized to have variance one: the reason is that the deviance residuals are divided by the dispersion estimate and not by the square root of the estimate for the dispersion. Should the function not be changed to produce residuals with a variance about 1? R 1.8.1 on
2005 Jun 13
1
Error in load(zfile, envir = envir) : input has been corrupted, with LF replaced by CR
I am trying to build a package binary, and get the message below. Can anyone point me to a solution to that problem. Thanks in advance S?ren .... installing data files installing man source files installing indices Error in load(zfile, envir = envir) : input has been corrupted, with LF replaced by CR Execution halted make[2]: *** [indices] Error 1 make[1]: *** [all] Error 2
2003 Nov 17
1
confint: which method attached?
the function confint uses the profiling method of the function of the package MASS confint.glm even after the package has been detached! 1: might this be the intenden behavior? 2. How does the function remember its 'MASS' functionality after detaching the package? R: 1.8.0; Windows 2000 Here is a sample program > set.seed(7882) > x<-rep(c(0,1),c(20,20)) >
2007 Jun 28
4
compare 2 vectors
Dear all, I would like to take out the values from one vector that are equal to the values in another vector. Example: a <- c(1,2,3,4,5,6,7,8,9) b <- c(3,10,20,5,6) b_noRepeats = c(10,20) So I would like to have the vector b without the same values as vector a. Kind regards, João Fadista [[alternative HTML version deleted]]
2005 Jul 12
10
Computer algebra in R - would that be an idea??
>From time to time people request symbolic computations beyond what D() and deriv() etc can provide. A brief look at the internet shows that there are many more or less developed computer algebra packages freely available. Therefore, I wondered if it would be an idea to try to 'integrate' one of these packages in R, which I guess can be done in more or less elegant ways... I do not know
2007 Sep 05
6
length of a string
Dear all, I would like to know how can I compute the length of a string in a dataframe. Example: SEQUENCE ID TGCTCCCATCTCCACGG HR04FS000000645 ACTGAACTCCCATCTCCAAT HR00000595847847 I would like to know how to compute the length of each SEQUENCE. Best regards, João Fadista [[alternative HTML version deleted]]