similar to: SNPRelate package error

Dear, I am using the R package SNPRelate but I found an error when I run the following command. Do you know what might be the problem? Thanks in advance. > vcf.fn <- system.file("extdata","str.vcf",package="SNPRelate") > snpgdsVCF2GDS(vcf.fn,"test.gds") Start snpgdsVCF2GDS ... Extracting bi-allelic and polymorhpic SNPs.

Hi, I would like to know how can I keep adding data to a file while doing a loop and without deleting the data of the previous iteration. Thanks.

Hi, Following my earlier posts about having problems performing a PCA, I have worked out what the problem is. The problem lies within the PLINK to gds conversion. It seems as though the SNPs are imported as "samples" and in turn, the samples are recognised as SNPs: >snpsgdsSummary("chr2L") Some values of snp.position are invalid (should be > 0)! Some values of

Hi all, I'm trying to download a file from the net, and the download.file command leaves it corrupted, i.e excel cannot open it. It seems as if it's going ok, however. Does anyone have an idea of what's going on? regards, Gustaf Rydevik ---- >download.file(url="http://www.who.int/entity/whosis/whostat2006_demographics.xls",destfile="whodem.xls") trying URL

Full_Name: Gustaf Rydevik Version: 2.7.1 OS: Win XP professional Submission from: (NULL) (130.237.97.254) The following lines of code crash R 2.7.1 (=cause R to show "The R gui has encountered a problem and needs to close"....). Replicated on two WinXp professional machines, as well as by Uwe Ligges. > sessionInfo() R version 2.7.1 (2008-06-23) i386-pc-mingw32 locale:

Hi, The added support for semi-transparent colours in `windows' under R-2.6.0 for Windows is much appreciated. However, I've discovered that issuing a `layout' (or `par' with arguments `mfcol'/`mfrow') call and then trying to plot several figures with semi-transparent colour on the same page results in only the first one being fully drawn. E.g. > x <-

It seems within the last ~3 months Ive been having issues with writing text or csv files from a R data frame.  The problem is multifold and it is hard to filter  out what is going on and where the problem is.  So, Im hoping someone else has come across this and may provide insight.   My current settings for R: R version 2.15.2 (2012-10-26) Platform: x86_64-w64-mingw32/x64 (64-bit) locale: [1]

On R 2.15.2 and ArcGIS 9.3.1, it works for me in ArcCatalog but you have to follow the particulars here: http://webhelp.esri.com/arcgisdesktop/9.3/index.cfm?TopicName=Accessing_delimited_text_file_data For example: write.table(test, '***.tab', sep = '\t', row.names = F) The extension .tab and sep = '\t' are required for text files. Didn't test row.names=T but I

Hi all, I am having some problems in updating some packages from source. I start with : install.packages("Boom",lib="C:/RownLib",type="source") I get the following error message : * installing *source* package 'Boom' ... ** package 'Boom' successfully unpacked and MD5 sums checked ** libs *** arch - i386 c:/Rtools/mingw_32/bin/g++ -std=gnu++11

On 03/06/2017 6:31 AM, Vivek Sutradhara wrote: > Hi all, > I am having some problems in updating some packages from source. I start > with : > install.packages("Boom",lib="C:/RownLib",type="source") > > I get the following error message : Do you have multiple copies of cygwin1.dll? Duncan Murdoch > > * installing *source* package

Hi, As far as I can see, no. On checking, I have confirmed that the only location of cygwin1.dll is : C:\Rtools\bin Thanks Vivek 2017-06-03 12:57 GMT+02:00 Duncan Murdoch <murdoch.duncan at gmail.com>: > On 03/06/2017 6:31 AM, Vivek Sutradhara wrote: > >> Hi all, >> I am having some problems in updating some packages from source. I start >> with : >>

On 03/06/2017 7:00 AM, Vivek Sutradhara wrote: > Hi, > As far as I can see, no. > > On checking, I have confirmed that the only location of > cygwin1.dll is : > C:\Rtools\bin I would re-install Rtools, and make sure C:\Rtools\bin appears first in your PATH. Duncan Murdoch > > Thanks > Vivek > > 2017-06-03 12:57 GMT+02:00 Duncan Murdoch <murdoch.duncan at

Hi, I don't know if this matters but it worked for me with no problems ?. > sessionInfo() R version 2.7.0 (2008-04-22) i386-pc-mingw32 locale: LC_COLLATE=English_United States.1252;LC_CTYPE=English_United States.1252;LC_MONETARY=English_United States.1252;LC_NUMERIC=C;LC_TIME=English_United States.1252 attached base packages: [1] stats graphics grDevices utils datasets

Dear all, I had a R segmentation fault, and then invoked debug mode and ran step by step. When I reached "terms(Y~X1*X2*...*X16)", I would then have "segmentation" fault. However, if I just ran this under regular "R interactive" mode, it would be fine though taking long time. My questions are: 1. Is there a known limit of terms for a formula? 2. Why does the

Dear all, I had a R segmentation fault, and then invoked debug mode and ran step by step. When I reached "terms(Y~X1*X2*...*X16)", I would then have "segmentation" fault. However, if I just ran this under regular "R interactive" mode, it would be fine though taking long time. My questions are: 1. Is there a known limit of terms for a formula? 2. Why does the

Hi, I am working on a regression tree in Rpart that uses a continuous response variable that is ordered. I read a previous response by Pfr. Ripley to a inquiry regarding the ability of rpart to handle ordinal responses in 2003. At that time rpart was unable to implement an algorithm to handle ordinal responses. Has there been any effort to rectify this in recent years? Thanks! Stacey On

Dear all, Can I do a permutation test if the number of individuals in one group is much bigger than in the other group? I searched the literature but I didin´t find any assumption that refers to this subject for permutation tests. Best regards João Fadista Ph.d. student UNIVERSITY OF AARHUS Faculty of Agricultural Sciences Dept. of Genetics and Biotechnology Blichers Allé 20, P.O.

Dear all, I would like to know how can I compute the length of a string in a dataframe. Example: SEQUENCE ID TGCTCCCATCTCCACGG HR04FS000000645 ACTGAACTCCCATCTCCAAT HR00000595847847 I would like to know how to compute the length of each SEQUENCE. Best regards, João Fadista [[alternative HTML version deleted]]

Dear all, I would like to know how can I create a binned column in a data.frame. The output that I would like is something like this: Start Binned_Start 1 0-5 2 0-5 6 5-10 8 5-10 13 10-15 ... Best regards João Fadista Ph.d. student UNIVERSITY OF AARHUS Faculty of Agricultural Sciences Dept. of Genetics and Biotechnology Blichers

Dear all, I would like to know how can I retrieve a data.frame without the columns that have a partial match name. Let´s say that I have a data.frame with 200 columns and 100 of them have the name "StartX", with X being the unique part for each column name. I want to delete all columns that have the name starting with "Start". I´ve tried to do this but it doesn´t work: >