similar to: rho stat from a fasta sequence file

Hi all, I am learning R by "doing". And this is my first post. I want to use R: 1- to fetch a DNA sequence from a databank (see bellow) and 2- store it as FASTA file. The problem: neither an error is prompted nor the fasta file is created. Testing the code (see bellow), I notice that everything works until the *"write.dna" *command - which is not creating the fasta file.

I suspect you meant WD <- "~/Documents/Scripting/R_Studio/Sequences/" but I am entirely unfamiliar with the packages you are using, and know nothing about what is on your hard drive. For future reference: A) Read the Posting Guide. This is a plain text email list, and your html formatting gets removed leaving a mess that is not always readable. B) Most frequent users of R

Hi I would like to use 'write.fasta(sequences, names, nbchar = 60, file.out, open = "w")' to convert a DNA sequence in a text file to fasta format. How do I read the the text file to prepare the argument 'sequences' of the function. The DNA sequence in the text file is one line as below: ATCACACAACGACACTCACCCTGGACGCTCATC......... Thank you [[alternative HTML

Hi everybody, I have a large fasta file(15M) which contains a lot of DNA sequence in fasta format.And i want to get probabilities matrix for 2nd order markov china from this background.Here is a web tool, http://tandem.bu.edu/markov.html.But i can not upload a large file. I wonder if there is a R packages can do this ,Thanks in advance . Jiantao Shi **

I am trying to pull a subset form a large group of FASTA sequences. I need to pull them based on the annot and write.fasta them. I have my subset annot titles in a .csv. What is the way to go about this? I tried pulling the sequences from a .csv but then MEGA 5 was not happy when i tried to put them back and I need to use MEGA to keep my data uniform. Any help would be greatly appreciated Thank

Hi - When I'm trying to read in a text file into a labeled character array, the memory stamp/footprint of R will exceed 4 gigs or more. I've seen this behavior on Mac OS X, Linux for AMD_64 and X86_64., and the R versions are 2.4, 2.4 and 2.2, respectively. So, it would seem that this is platform and R version independant. The file that I'm reading contains the upstream regions

Hi! I am trying to analyse my data using amova (http://www.oga-lab.net/RGM2/func.php?rd_id=pegas:amova): My input to R is a DNA sequence file, format=fasta dna<- read.dna("XX.fasta", format="fasta") #left other options as default d<- dist.dna(dna, model="raw") g<- read.table("XXX.design") Load necessary libraries: library(pegas)

I am trying to return an index for a data set by searching using filenames. The name may be ANG_AUT.N.0734C70411A-1_1sA_0734C70411A.fasta, but i'd just like to search it using the term "0734C70411" as the file may be 0734C70411A or 0734C70411C or 0734C70411D Any way to do this other than doing something like this. where 0734C70411A is part of matrix list[,8]

Dear R developers I am currently working on the seqinR package. The seqinR package allows a remote access to biological databases via a socket connection. We are using the functions socketConnection, writeLines and readLines to open the socket, send request to the server and receive response from the server respectively. Recently, a new function implemented in the socket server allows

Good afternoon. I am a master student in University of Porto in Portugal. At this moment I’m starting to use R, so I have some doubts. The aim of my analysis is: calculate a pairwise FST matrix from fasta file and creat a principal component analyses with adegenet package (I use seqinr and ape package to read this file, then I convert this file into a genind object with DNA2genind function

I tried the following, obviously it didn't work. Hope you get my point, how to do it in R ? My objective is to read a large fasta file (but not storing the entire data into memory) , and compute some sequence composition statistics. while(a <- readLines("test1") != EOF) print(a) _________________________________________________________________ [[alternative HTML version

Dear all, I have DNA sequence data which are fasta-formatted as >gene A;..... AAAAACCCC TTTTTGGGG CCCTTTTTT >gene B;.... CCCCCAAAA GGGGGTTTT I want to load only the lines that start with ">" where the annotation information for the gene is contained. In principle, I can remove the sequences before loading or after loading all the lines. I just wonder if there's a way to

Hi I am trying to read genbank est flat files. Is there any function in R to do that. I was looking for something similar to SeqIO.parse(input_handle, "genbank") in bioPython that convert the genebank sequence into fasta sequence. (One option is to call biopython from R but I am not familiar with python functions so I want to avoid that and I am keeping it as last resort) Thanks and

Through converting a miRNAs file from FASTA to character format I get a vector which looks like the following: > nml [1] "hsa-let-7a MIMAT0000062 Homo sapiens let-7a" [2] "hsa-let-7b MIMAT0000063 Homo sapiens let-7b" [3] "hsa-let-7c MIMAT0000064 Homo sapiens let-7c" [4] "hsa-let-7d MIMAT0000065 Homo sapiens

https://bugzilla.samba.org/show_bug.cgi?id=5963 Summary: rsync fails with errors that make no sense... Product: rsync Version: 3.0.4 Platform: x86 OS/Version: Linux Status: NEW Severity: major Priority: P3 Component: core AssignedTo: wayned@samba.org ReportedBy: crhea@mayo.edu

Hi, Try this: lines1<- readLines(textConnection("gene1 or1|1234 or3|56 or4|793 gene4 or2|347 gene5 or3|23 or7|123456789")) lines2<-readLines(textConnection(">or1|1234 ATCGGATTCAGG >or2|347 GAACCTATCGGGGGGGGAATTTATATATTTTA >or3|56 ATCGGAGATATAACCAATC >or3|23 AAAATTAACAAGAGAATAGACAAAAAAA >or4|793 ATCTCTCTCCTCTCTCTCTAAAAA >or7|123456789

HI Utpal, Alight, I will look into it.? I was under the impression that this is what you wanted: dat1<- structure(list(V1 = c(1L, 1L, 1L, 1L, 1L, 1L, 1L), V2 = c(1L, 1L, 1L, 1L, 1L, 1L, 0L), V3 = c(1L, 1L, 1L, 1L, 1L, 1L, 1L), ??? V4 = c(1L, 1L, 0L, 1L, 1L, 1L, 1L), V5 = c(1L, 1L, 1L, 1L, ??? 1L, 0L, 1L), V6 = c(1L, 1L, 1L, 0L, 1L, 1L, 1L), V7 = c(1L, ??? 1L, 1L, 1L, 1L, 1L, 1L), V8 = c(1L,

Dear R users, seqinR 1.0-5 has been released yesterday on CRAN, so that the source code of the package should be available on all CRAN mirrors within the next 24h. The updated package vignette is here: http://pbil.univ-lyon1.fr/software/SeqinR/seqinr_1_0-5.pdf User level visible changes are: o A new function dotPlot() is now available.

Dear R users, seqinR 1.0-5 has been released yesterday on CRAN, so that the source code of the package should be available on all CRAN mirrors within the next 24h. The updated package vignette is here: http://pbil.univ-lyon1.fr/software/SeqinR/seqinr_1_0-5.pdf User level visible changes are: o A new function dotPlot() is now available.

Dear all, I have data.frame object in R. I want to export it in tab-delimited file with several lines of header initiated with comment sign (#). I do not know how to do that in R. Could you please give helps on this problem? Thanks in advance. Best, Jian-Feng, ################################################################## The lines I want to write in the header lines look like, with words