similar to: Pb w2k <-> samba

Displaying 20 results from an estimated 800 matches similar to: "Pb w2k <-> samba"

2002 Mar 01
1
Excel Add-in
I'm trying to make a connexion beetween Excel and R. It works for simple requests but it seems that complexe functions won't work. Does anybody knows how complexe can be the data set and function used? Does it exist something else than the Erich Neuwirth Add-in (which is already really interesting) ? Thanks Nolwenn ----------------------------------------------------------------------
2003 Jun 19
3
sciViews
Bonjour, J'ai t?l?charg? SciViews Insider que je trouve tr?s convivial. Par contre, je n'arrive pas ? comprendre comment enregistrer un script R en type de fichier R justement. Mes programmes fonctionnent tr?s bien, mais SciViews me propose uniquement de les enregistrer au format txt sous un type de fichier "bloc notes". Comment les enregistrer avec l'extension .R comme le
2003 Jun 26
3
create help files
Hello, I have to create help files on R. I used the "package.skeleton" function which allowed to me to create a personal package with my list of functions. But I don't understand what I have to install to use these. That needs the tools to build packages from source to be installed. I will need the files in the R binary Windows distribution for installing source packages to be
2002 Jun 26
6
Samba 2.2.5 and printers
I'm currently having a problem with the new released Samba 2.2.5: I cannot print anymore on my shared printer. What is strange is that It worked fine with samba 2.2.4, but now I got an access denied whenever I try to access the printer... /var/spool/lpd/samba is chmod 777 and the username is in the group lp Here is part of my smb.conf: [global] workgroup = HOME netbios name =
2002 Mar 07
2
Statconnector and Excel
Hi, I'm trying to combine a VBA macro and a R package. I've installed the R-(D)COM and the R-excel interface by Neuwirth. They seem to work both. However I would like to display the r-generated data in an Excel sheet as an array but I don't manage. Here is an example of my source: Sub doR() Call RInterface.StartRServer Call RInterface.RRun("library(mdnn)") Call
2006 May 18
2
help
Dear Sir, I’am a frensh student and i’am a new user of the R software. After using the command (x<-read.delim(“clipboard”) to read a spreadsheet of Excel, I want to run the bds test and calculate the Lyapunov exponent. I have charged the R software by the packages tseries and tseriesChaos. when i run bds.test(x,m=2) Unfortunately the R software displays “error in as.vector(x,mode= “double”) :
2002 May 14
2
Error in joining samba server to Windows Domain
Hi, I've installed samba 2.2.3a on HPUX11.0 and are currently trying to join the samba server to our Windows Domain... However, I encountered this error : Error connecting to *SMBSERVER Unable to join domain XXXX Has anyone encountered this problem before ? What was the solution ? thanks & rgds, Jesse Chan
2002 Jun 28
0
Tr: RE: Samba 2.2.5 and printers
Ok, I solved the problem by myself. The problem was that the users with wich I tried to connect to the printer where defined as admin users, and I declared root as an invalid user in the samba configuration, so it always give me an access denied because it tried to connect as root. Anyway thanks for the time you waste trying to help me ;-) ----Message r?exp?di?---- >Date: Thu, 27 Jun 2002
2001 Dec 17
1
vorbis physical bitstream structure
Hello, could somenone please describe me the vorbis specific physical bitstream structure, as I haven't found any documentation about it. Thank you ******************* Pierre-Henri Quelen phq@laposte.net "Accédez au courrier électronique de La Poste : www.laposte.net ; 3615 LAPOSTENET (0,13 €/mn) ; tél : 08 92 68 13 50 (0,34€/mn)" --- >8 ---- List archives:
2006 Dec 15
4
_exit_cleanup(code=12, file=token.c, line=419): about to call exit(12)
Hy all, I'm a new rsync user and my english may be poor. I try to sync two folders between two machines using ssh and 2.6.9 rsync version on each. My purpose is to sync only files called "*.lic" in each subfolders. On the source machine I want to sync : /home/dps3/public/Lic/Lic /home/dps3/public/Lic/Lic2 /home/dps3/public/Lic/Lic3 to /home/dps3/public/Lic/Lic9 On each
2009 Nov 30
1
RSQLite does not read very large values correctly
Hello, I am trying to import data from an SQLite database to R. Unfortunately, I seem to get wrong data when I try to import very large numbers. For example: I look at the database via SQLiteStudio(v.1.1.3) and I see the following values: OrderID Day TimeToclose 1 2009-11-25 29467907000 2 2009-11-25 29467907000 3 2009-11-25 29467907000 Now I run this R Code: >
2004 Feb 03
0
GEE
Bonjour, J'etudie une population de chevaux en captivite. Je souhaite identifier le ou les facteurs qui influencent la fecondite des femelles (=nombre de poulain= 0 ou 1) depuis 1995 jusqu'a 2003. Les variables explicatives sont donc disponibles pour les femelles par annee : fem1_annee1 fem2_annee1 fem3_annee1 fem1_annee2 fem2_annee2 fem3_annee2 fem4_annee2 etc. Le nombre de femelles
2005 May 18
1
[LLVMdev] runtest on cygwin for a gdb built on mingw failed
Hi, as you know dejagnu and expect have not yet been ported to MinGW correctly, so, I need to know how can I run runtest on cygwin for a gdb that was built on mingw Accédez au courrier électronique de La Poste : www.laposte.net ; 3615 LAPOSTENET (0,34€/mn) ; tél : 08 92 68 13 50 (0,34€/mn) -------------- next part -------------- An HTML attachment was scrubbed... URL:
2006 Jun 29
1
[SAMBA+ADS] Getent passwd does not show AD computers
Hi everybody, I'll try to make it quick... Our configuration : -1 x Windows 2003 Active Directory Server + LDAP Server -1 x SuSE 10 SAMBA Server Authentication = LDAP + Kerberos. Everything is running smothly : AD Users can authenticate and browse the network shares presented by Samba. However, it seems that the AD computers are not "recognized"... "getent passwd" only
2004 Jan 07
3
PDF printer and wiidows driver auto-download.
Hello =) I got some problem configuring a pdf printer and make windows to download automagically drivers from [print$] share on my samba 3.0.1 server. Well, I've configured a pdf printer (based on this doc: http://www.linuxgazette.com/issue72/bright.html), tested it and it works pretty well =) To install the printer on windows side, I connect to the host, browse to samba server, right-click
2005 Aug 05
3
Popup menu attached to a FXTreeItem
Hi, I''m using FXRuby 1.0 on Windows. I''d like to display a popup menu after a right click on a tree item, I cannot make it work : #-------------------- root = FXTreeList.new(parent, 1, self, 0) pop = FXMenuPane.new(parent) expandCmd = FXMenuCommand.new(pop, "Expand", nil, app) expandCmd.connect(SEL_COMMAND) { root.currentItem.expanded=(true) }
2002 May 02
2
a question
Hi, I have a program written in R which is good on the version 1.2, but for the fallowing versions of R, an error always is at the same place. That is at the level of the fallowing line: Sur<- getInitial(res2[m:M,2]~SSasymp(res2[m:M,1],Asymp,resp0,lrc),data=res2) Error in eval(expr,envir,enclos):numeric envir arg not of length one I don't know at all this langage for the instant.
2006 Apr 17
7
help
Hi, I am trying to runn a age-period-cohort model, but here is what I am having problem with, hope you can help me! This is what I am trying to do: sumzero_a<-((A-min(A))/5+1) - mean((A-min(A))/5+1) where A is my age variable (numeric, the mid-point of a five-year age group), but I got the following error: Error in min(..., na.rm = na.rm) : invalid 'mode' of argument I am pretty
2011 Apr 16
2
Chinese character is not shown properly for some programs
Just dived into linux recently and spent a whole day on trying geing chinese programs working properly in wine. The situation is that some chinese programs (like eMule) display Chinese character very nicely while some others can not. Here is the screenshot: [Image: http://www.jg300.com/www/Screenshot-dzh.png ] What I have done: 1. apt-get ttf-wqy-microhei 2. Copy the downloaded font to
2012 Feb 29
1
codon usage bias
Hey guys, I have what i think is a really simple problem :( I installed the seqinr library. I want to do an RSCU analysis. But i can't get it to work in even the simplest case. for example, if i have a string read in: > newdata5 $testseq [1] "agtgagatgatagatagatagatagatagatagatagaccccccagata" and then i perform an RSCU analysis on it... >