similar to: R package install problem

Dear folks, Please welcome a newbie both to R and the mailing list :). I am currently working on a sequencing project, and heard about R as well as some of its packages for next gen sequencing, and decided to give it a try. Starting with ShortRead, I found a document (http://www.bioconductor.org/packages/2.5/bioc/vignettes/ShortRead/inst/doc/ShortRead_and_HilbertVis.pdf) which does mention

Hi, I want to group a large list (20 million) of strings into categories based on string similarity? The specific problem is: given a list of DNA sequence as below ACTCCCGCCGTTCGCGCGCAGCATGATCCTG ACTCCCGCCGTTCGCGCGCNNNNNNNNNNNN CAGGATCATGCTGCGCGCGAACGGCGGGAGT CAGGATCATGCTGCGCGCGAANNNNNNNNNN CAGGATCATGCTGCGCGCGNNNNNNNNNNNN ...... ..... NNNNNNNCCGTTCGCGCGCAGCATGATCCTG

Hi, I understand ShortRead::FastqStreamer will read chunks in parallel depending on the value of ShortRead:::.set_omp_threads I see this discussed here: https://stat.ethz.ch/pipermail/bioc-devel/2013-May/004355.html and nowhere else. It probably should be documented in ShortRead. Possibly this has already changed for I am using still R 3.1.0. I thought I'd check. Oh, and, in my

Hi I work for a medium sized University and have recently set up some new infrastructure to authenticate our wireless users of Active Directory. Every thing was working as expected or so I thought. I set up a monitoring script that performs an ntlm_auth every minute and it shows that the authentication is failing inconsistently but for around 5 minutes at a time (see below). There are two

I am trying to setup a portrait mode screen. I can see that in 3.85, there is an enhancement which allows arbitrary resolutions (http://git.kernel.org/?p=boot/syslinux/syslinux.git;a=commitdiff;h=5d4ade0221c2387345d0a82422866bb8b937cb09). Can I use this new feature to achieve setting the portrait mode. What is the syntax in the config file to set it? Also, is there any other vesa driver

HI, I would like to update my DESeq package version on R-2-14 using bioclite() and get this message, could somebody help please? > biocLite("DESeq") BioC_mirror: 'http://www.bioconductor.org' Using R version 2.14, BiocInstaller version 1.2.1. Installing package(s) 'DESeq' Installing package(s) into ?/nfs/team82/nac/R-modules? (as ?lib? is unspecified) trying URL

Hi, I did a quick search for other packages that provide the beta binomial distribution and found "rmutil". > install.packages("rmutil") The package has the CDF (pbetabinom) and inverse CDF (qbetabinom) among other functions. HTH, Eric On Wed, Nov 1, 2017 at 7:50 AM, MCGUIRE, Rhydwyn < rmcgu at doh.health.nsw.gov.au> wrote: > Hi there, > > It looks like

Hello, Thank you for your response. I need to install RankTail package since it contains the beta binomial distribution, CDF and inverse CDF in the usual form which I need to use. However rmutil package contain unusual forms for these functions. So it is easier for me to deal with the forms are contained in RankTail. I tried to install bioconductor package, using the following commands but I

Dear list, How can I detect a package is installed or not? If not, then install it. For example, in a script, I want to check the package DESeq is installed or not. If not, then I will using this script to install it. source("http://www.bioconductor.org/biocLite.R") biocLite("DESeq") The pseudo script would be like this: try: library("DESeq") catch:

Dear All, I am trying to build a package for a set of functions. I am able to build the package and its working fine. When I check it with R CMD check I get a following warning : no visible global function definition for ‘biocLite’ I have used biocLite to load a user defined library from within a function if that library is not pre-installed

Neither biocLite nor the GUI menus can install packages on my system. Here is relevant output: > version _ platform i386-pc-mingw32 arch i386 os mingw32 system i386, mingw32 status major 2 minor 11.1 year 2010 month 05 day 31 svn rev 52157 language R version.string R version 2.11.1 (2010-05-31) > source("http://bioconductor.org/biocLite.R") BioC_mirror =

Hi All, I tried to install the package of Rgraphviz in the following two ways successfully: source("http://bioconductor.org/biocLite.R") biocLite("Rgraphviz") install.packages(pkgs="C:/Progra~1/R/lib_download/Rgraphviz_1.24.0.zip", lib="C:/Progra~1/R/R-2.10.1/library", repos=NULL) but when I loaded the package though library(Rgraphviz) or

I've asked a question in the BioConductor list about package management. My solution depends on your answer to the following question. Are installed R packages "relocatable"? I mean relocatable in the same sense that files in a RedHat RPM file might be "relocatable" after compiling (http://www.rpm.org/max-rpm/ch-rpm-reloc.html). This allows one to build a package as the

To whom it may concern. As I would like to analyse some array data I was keen on downloading the lumi package that depends obviously on hdrcde that is not available for r 2.12.1. I did not find instructions to solve or circumvent this problem. Installing hdrcde by hand did not work either. It was not detected by > (.packages(all.available=TRUE)) if installed in the R library. Thanks Hermann

In pvec(list(1, 2), FUN, mc.cores=2) FUN sees integer() arguments whereas pvec(list(1, 2, 3), FUN, mc.cores=2) FUN sees list() arguments; the latter seems consistent with pvec's description. This came up in a complicated Bioconductor thread about generics and parallel evaluation https://stat.ethz.ch/pipermail/bioc-devel/2012-October/003745.html One relevant point is that a

Why am I seeing the following in R-devel (sept 2, 2006 build) on opensuse 10.1? I'm sure it is something simple I am missing, but I just don't see it (output below). Thanks, Sean > readLines(url("http://www.bioconductor.org/biocLite.R")) [1] "source(\"http://bioconductor.org/getBioC.R\")" [2] ""

The warnings from make.packages.html() on the Apple Mac OS X platform can be dealt with as follows: ------------------------------------------------ (1) make.packages.html() uses the function tempdir() and attempts to create a temporary directory in the default location /tmp/ which fails due to the /tmp directory architecture on the Mac. I set up a .Renviron file in my user account

Hi Nguyen, > Subject: [R] install "multtest" and "preprocessCore" packages in > Bioconductor library > Date: Wed, 30 Nov 2011 09:57:36 -0800 > From: UyenThao Nguyen <unguyen at tethysbio.com> > To: r-help <r-help at r-project.org> > CC: uth.nguyen at ucdavis.edu <uth.nguyen at ucdavis.edu> > > Hi All, > > I've tried to

--- On Tue, 15/7/08, haani hanni <maaryam_khan@yahoo.com> wrote: From: haani hanni <maaryam_khan@yahoo.com> Subject: how i can install Rgraphviz in R2.7.1 To: "Nabble" <support@nabble.com> Cc: r-help-request@r-project.org Date: Tuesday, 15 July, 2008, 1:39 PM hello i am a new user of R.i have window XP Proffessional in my P.C.i wanted to make the graphs of my

Hi, I am unable to install packages on my R 2.12.0 Windows 7 machine. Here are the relevant lines: sessionInfo() R version 2.12.0 (2010-10-15) Platform: x86_64-pc-mingw32/x64 (64-bit) locale: [1] LC_COLLATE=English_United States.1252 LC_CTYPE=English_United States.1252 LC_MONETARY=English_United States.1252 [4] LC_NUMERIC=C LC_TIME=English_United States.1252