search for: seq2

Hi everybody, I'm using a vector to strore some strings. I create a vector named seq2 : > seq2<-vector(length=0) I have a string named b > b [1] CATGGTAGGAATAC I put b in the vector > seq2<-c(seq2,b) Finally I edit seq2 > seq2 [1] "14760" My question is why I obtained a number (14760) when I add a string (CATGGTAGGAATAC) I have an idea : when I edit...

...something in my data crashes dovecot. I was using 1.0.rc14 from opensuse, but downloaded and installed 1.0.8 from the site. Here is the crash: Dec 5 18:05:09 h743107 dovecot: IMAP(kris): file mail-index-transaction.c: line 629 (mail_index_update_flags_range): assertion failed: (seq1 <= seq2 && seq1 > 0) Dec 5 18:05:09 h743107 dovecot: child 13896 (imap) killed with signal 6 Dec 5 18:05:09 h743107 dovecot: IMAP(kris): Raw backtrace: imap [0x8006cf7d] -> imap [0x8006ce58] -> imap(mail_index_update_flags_range+0x194) [0x8004d034] -> imap(mail_index_sync_begin+0...

...pare and count the number of mismatches and record the number of mismatches in a new column. The sequences are part of a data frame that looks like this: seq1=c("CGGTGTAGAGGAAAAAAAGGAAACAGGAGTTC","CGGTGGTCAGTCTGGGACCTGGGCAGCAGGCT", "CGGGCCTCTCGGCCTGCAGCCCCCAACAGCCA") seq2=c("AGGTGTAGAGGAAAAAAAGGAAACAGGAGTTC","CAGTGGTCAGTCTGGGACCTGGGCATCAGGCT", "CGGGCCTCTCGGCCTGCAGCCCCCAACAGCCA") d.f=data.frame(seq1, seq2) thank you for your help Joseph ____________________________________________________________________________________ Looki...

I would like to create a subtotal table with custom bands. seq1 = seq(0, 100, by = 5) seq2 = seq(100, 1000, by = 100) Bands = c(seq1, seq2) #Prices Prices = sample(1:1000, 200, replace=F) #corresponding size for the given price above. size = sample(1:1000, 200, replace=F) How would I find the subtotal of the size based on a given price falls within a band? -- View this messag...

...e("4.2.2002 07:00", format="%d.%m.%Y %H:%M")) seq1 <- seq(d1, d2, "hours") seq1 d3 <- as.POSIXct(strptime("2.2.2002 15:22", format="%d.%m.%Y %H:%M")) d4 <- as.POSIXct(strptime("3.2.2002 18:12", format="%d.%m.%Y %H:%M")) seq2 <- seq(d3, d4, "hours") seq2 How to select timestamps from seq1 which are just before and after of particular timestamp in seq2? The resulting vector should look like this in this example: "2002-02-02 15:00:00 Normaaliaika" "2002-02-02 16:00:00 Normaaliaika" &quot...

I have three character strings represented below as seq1, seq2, and seq3. Each string has a reference character different from the other. Thus, for seq1, the reference character is U, seq2, S (3rd S from left where A is leftmost character) and for seq3 Y. seq1 = PQRTUWXYseq2 = AQSDSSDHRSseq3 = EEZYJKFFBHO I wish to generate a 3 by 26 matrix where 3 represent s...

...have used) I never had problems in reading them in, as for example: > a <- read.table("coords.bed", skip=1) > disp(a) class data.frame dimensions are 38650 6 first rows: V1 V2 V3 V4 V5 V6 1 chr1 100088396 100088446 seq1 0 + 2 chr1 100088764 100088814 seq2 0 - If I do exactly the same command on the same file in R-2.7.0 the result I obtain is: > a <- read.table("coords.bed", skip=1) > disp(a) class data.frame dimensions are 38650 6 first rows: V1 V2 V3 V4 V5 V6 1 chr1 100088396 100088446 seq1 0 0 2 c...

...lla" ... The names of each entry in first list match exactly the names of the entries in the second list and both list contain the same number of sequences (although not of the same length) I want to concatenate these sequences by the following function: interleave <- function(seq1, seq2) { #create a list to contain concatenated sequences sequence <- list() for (name in names(seq1)) # get names as indices { # concatenate sequences sequence[[name]] <- c(seq1[[name]], seq2[[name]]) } # return concatenated sequences invisible(sequence) } I guess the f...

Hi, I have yet another problem with Dovecot: sometimes (rarely, maybe once every few days) one of the imap processes will 'hang', consuming all available CPU time. It does not seem to 'finish' in any reasonable amount of time (in one instance I waited a few days). This process will not even exit gracefully, it needs to be killed with 'kill -9 <PID>'. It has

...39; doesn't use compact internal >> representation. However, looking at the code of function >> 'seq.default', seq(1,n) produces 1:n. What is going on? > > It looks like it is related to using compiled or interpreted code: > > > library(gtools) > > seq2 <- unByteCode(seq.default) > > .Internal(inspect(seq.default(1,10))) > @7fa53847dcd8 13 INTSXP g0c4 [] (len=10, tl=0) 1,2,3,4,5,... > > .Internal(inspect(seq2(1,10))) > @7fa537fa0bf0 13 INTSXP g0c0 [NAM(3)]? 1 : 10 (compact) > > Duncan Murdoch > >> >>&g...

> .Internal(inspect(1:10)) @300e4e8 13 INTSXP g0c0 [NAM(3)] 1 : 10 (compact) > .Internal(inspect(seq(1,10))) @3b6e1f8 13 INTSXP g0c4 [] (len=10, tl=0) 1,2,3,4,5,... > system.time(1:1e7) user system elapsed 0 0 0 > system.time(seq(1,1e7)) user system elapsed 0.05 0.00 0.04 It seems that result of function 'seq' doesn't use compact

I just noticed one instance of this in the current CVS version: dovecot: Jul 18 15:25:48 Error: 5962 IMAP(mailuser): mbox sync: Expunged message reappeared in mailbox /mailhome/new/o/h/mailuser/mbox (UID 2834 < 2872) dovecot: Jul 18 15:25:48 Error: 5962 IMAP(mailuser): file mail-index-transaction.c: line 129 (mail_index_buffer_convert_to_uids): assertion failed: (*seq != 0) dovecot: Jul

Hello Julien, Am Mon, 14 Jan 2019 22:15:47 +0100 schrieb Julien dupont <marcelvierzon at gmail.com>: > ** Test 1 ** > On VPN_office I use 'tcpdump -npi any icmp and host 192.168.1.3' > When pinging 192.168.1.1 from client 1, with no success, I see no packet > passing. Sorry - the tcpdump command should end with "192.168.1.1" instead of

...ts the messages: --- Jun 22 17:19:07 parkheights dovecot: imap-login: Login: user=<seriv>, method=plain, rip=66.80.117.2, lip=192.168.10.14, TLS Jun 22 17:19:26 parkheights dovecot: IMAP(seriv): file index-search.c: line 845 (search_get_seqset): assertion failed: (ctx->seq1 <= ctx->seq2) Jun 22 17:19:26 parkheights dovecot: child 25812 (imap) killed with signal 6 --- and this lines repeat and repeat. At the same time I can open some INBOX' subfolders at the same server. So, I think it is a problem not with a server's software, but with mail storage. Help me, please, -...

Hello Julien, Am Tue, 15 Jan 2019 09:30:23 +0100 schrieb Julien dupont <marcelvierzon at gmail.com>: > In that case I see: > IP 172.16.0.3 > 192.168.1.1: ICMP echo request, id2135, seq1, length 64 > IP 172.16.0.3 > 192.168.1.1: ICMP echo request, id2135, seq2, length 64 > IP 172.16.0.3 > 192.168.1.1: ICMP echo request, id2135, seq3, length 64 > > Packet goes through but no PONG back if I understand correctly. That's > probably where it goes wrong. Yes, the final response is missing. But the above output also lacks the forwarded pack...

Hi suppose I have two arrays x1,x2 of dimensions a1,b1,c1 and a2,b2,c2 respectively. I want x = x1 "+" x2 with dimensions c(max(a1,a2), max(b1,b2),max (c1,c2)) with x[a,b,c] = x1[a1,b1,c1] + x2[a2,b2,c2] if a <=min(a1,a2) , b<=min (b1,b2), c<=min(c1,c2) and the other bits either x1 or x2 or zero according to whether the coordinates are "in range" for

...secs). 4 uid search not 2 * SEARCH 1 3 4 OK Search completed (0.000 secs). 5 uid search not 99 Connection closed by foreign host. zsh: exit 1 telnet localhost imap gdb backtrace is the following: #0 search_msgset_fix (messages_count=3, seqset=<value optimized out>, seq1_r=0x9340f8, seq2_r=0x9340fc, not=true) at index-search.c:774 range = 0x9328a0 count = <value optimized out> min_seq = 1 max_seq = <value optimized out> #1 0x00007f675a215663 in search_msgset_fix (messages_count=3, args=0x9327d8, seq1_r=0x9340f8, seq2_r=0x9340fc) at i...

...; It seems that result of function 'seq' doesn't use compact internal representation. However, looking at the code of function 'seq.default', seq(1,n) produces 1:n. What is going on? It looks like it is related to using compiled or interpreted code: > library(gtools) > seq2 <- unByteCode(seq.default) > .Internal(inspect(seq.default(1,10))) @7fa53847dcd8 13 INTSXP g0c4 [] (len=10, tl=0) 1,2,3,4,5,... > .Internal(inspect(seq2(1,10))) @7fa537fa0bf0 13 INTSXP g0c0 [NAM(3)] 1 : 10 (compact) Duncan Murdoch > >> h <- seq.default >> environmen...

...and_copy_to_user +static inline __wsum csum_and_copy_to_user diff --git a/include/net/dn_nsp.h b/include/net/dn_nsp.h index 413a15e5339c..771d3943a8f9 100644 --- a/include/net/dn_nsp.h +++ b/include/net/dn_nsp.h @@ -147 +147 @@ struct srcobj_fmt { -static __inline__ int dn_before(__u16 seq1, __u16 seq2) +static inline int dn_before(__u16 seq1, __u16 seq2) @@ -156 +156 @@ static __inline__ int dn_before(__u16 seq1, __u16 seq2) -static __inline__ int dn_after(__u16 seq1, __u16 seq2) +static inline int dn_after(__u16 seq1, __u16 seq2) @@ -164 +164 @@ static __inline__ int dn_after(__u16 seq1, __u16...

...ead of > "192.168.1.3". > (everything following "any" is a filter for the interesting traffic) > > Yes obviously. In that case I see: IP 172.16.0.3 > 192.168.1.1: ICMP echo request, id2135, seq1, length 64 IP 172.16.0.3 > 192.168.1.1: ICMP echo request, id2135, seq2, length 64 IP 172.16.0.3 > 192.168.1.1: ICMP echo request, id2135, seq3, length 64 Packet goes through but no PONG back if I understand correctly. That's probably where it goes wrong. > > > When pinging 192.168.1.3 from client 1, with success, I see packet > passing: > &gt...