search for: seq1

...ortunately, something in my data crashes dovecot. I was using 1.0.rc14 from opensuse, but downloaded and installed 1.0.8 from the site. Here is the crash: Dec 5 18:05:09 h743107 dovecot: IMAP(kris): file mail-index-transaction.c: line 629 (mail_index_update_flags_range): assertion failed: (seq1 <= seq2 && seq1 > 0) Dec 5 18:05:09 h743107 dovecot: child 13896 (imap) killed with signal 6 Dec 5 18:05:09 h743107 dovecot: IMAP(kris): Raw backtrace: imap [0x8006cf7d] -> imap [0x8006ce58] -> imap(mail_index_update_flags_range+0x194) [0x8004d034] -> imap(mail_index_s...

Hi, I am using package deSolve to run some ordinary differential equations (ODE) as part of a mathematical modeling project. I have solved for the following equilibrium states: Seq1<-a*(1-Neq1)/(f*Veq1+m+d) Ceq1<-(f*Seq1*Veq1+g*Ieq1+r*(1-Neq1)-b1*Veq1*Ieq1)/(b2+m+d+g) Ieq1<-(-b2*Ceq1)-r*(1-Neq1)/(b1*Veq1-g-u) Veq1<-o*(Ceq1+Ieq1)/e I want to take the differential of both sides of the equation and then solve for the inverse of the first as follows (the parameter val...

Hello I have 2 columns of short sequences that I would like to compare and count the number of mismatches and record the number of mismatches in a new column. The sequences are part of a data frame that looks like this: seq1=c("CGGTGTAGAGGAAAAAAAGGAAACAGGAGTTC","CGGTGGTCAGTCTGGGACCTGGGCAGCAGGCT", "CGGGCCTCTCGGCCTGCAGCCCCCAACAGCCA") seq2=c("AGGTGTAGAGGAAAAAAAGGAAACAGGAGTTC","CAGTGGTCAGTCTGGGACCTGGGCATCAGGCT", "CGGGCCTCTCGGCCTGCAGCCCCCAACAGCCA") d.f=data.frame(s...

I would like to create a subtotal table with custom bands. seq1 = seq(0, 100, by = 5) seq2 = seq(100, 1000, by = 100) Bands = c(seq1, seq2) #Prices Prices = sample(1:1000, 200, replace=F) #corresponding size for the given price above. size = sample(1:1000, 200, replace=F) How would I find the subtotal of the size based on a given price falls within a b...

R-users, I have two vectors (of timestamps) d1 <- as.POSIXct(strptime("2.2.2002 07:00", format="%d.%m.%Y %H:%M")) d2 <- as.POSIXct(strptime("4.2.2002 07:00", format="%d.%m.%Y %H:%M")) seq1 <- seq(d1, d2, "hours") seq1 d3 <- as.POSIXct(strptime("2.2.2002 15:22", format="%d.%m.%Y %H:%M")) d4 <- as.POSIXct(strptime("3.2.2002 18:12", format="%d.%m.%Y %H:%M")) seq2 <- seq(d3, d4, "hours") seq2 How to select timestam...

I have three character strings represented below as seq1, seq2, and seq3. Each string has a reference character different from the other. Thus, for seq1, the reference character is U, seq2, S (3rd S from left where A is leftmost character) and for seq3 Y. seq1 = PQRTUWXYseq2 = AQSDSSDHRSseq3 = EEZYJKFFBHO I wish to generate a 3 by 26 matrix where 3 repre...

...2.6.2patched (and every past version I have used) I never had problems in reading them in, as for example: > a <- read.table("coords.bed", skip=1) > disp(a) class data.frame dimensions are 38650 6 first rows: V1 V2 V3 V4 V5 V6 1 chr1 100088396 100088446 seq1 0 + 2 chr1 100088764 100088814 seq2 0 - If I do exactly the same command on the same file in R-2.7.0 the result I obtain is: > a <- read.table("coords.bed", skip=1) > disp(a) class data.frame dimensions are 38650 6 first rows: V1 V2 V3 V4 V5 V6 1 c...

...crophylla" ... The names of each entry in first list match exactly the names of the entries in the second list and both list contain the same number of sequences (although not of the same length) I want to concatenate these sequences by the following function: interleave <- function(seq1, seq2) { #create a list to contain concatenated sequences sequence <- list() for (name in names(seq1)) # get names as indices { # concatenate sequences sequence[[name]] <- c(seq1[[name]], seq2[[name]]) } # return concatenated sequences invisible(sequence) } I guess...

I just noticed one instance of this in the current CVS version: dovecot: Jul 18 15:25:48 Error: 5962 IMAP(mailuser): mbox sync: Expunged message reappeared in mailbox /mailhome/new/o/h/mailuser/mbox (UID 2834 < 2872) dovecot: Jul 18 15:25:48 Error: 5962 IMAP(mailuser): file mail-index-transaction.c: line 129 (mail_index_buffer_convert_to_uids): assertion failed: (*seq != 0) dovecot: Jul

Hello Julien, Am Mon, 14 Jan 2019 22:15:47 +0100 schrieb Julien dupont <marcelvierzon at gmail.com>: > ** Test 1 ** > On VPN_office I use 'tcpdump -npi any icmp and host 192.168.1.3' > When pinging 192.168.1.1 from client 1, with no success, I see no packet > passing. Sorry - the tcpdump command should end with "192.168.1.1" instead of

Dear R experts, I have two matrix (seq & mat) & I want to retrieve in a new matrix all the numbers from mat that =1 (corresponding to the same row/ column position) in seq, or all the numbers in mat that =-1 in seq. - Replace all the numbers with NA if it's not 1/-1 in seq. There are some "NA"s in seq. seq=matrix(c(1,-1,0,1,1,-1,0,0,-1,1,1,NA),3,4)

...t; Sorry - the tcpdump command should end with "192.168.1.1" instead of > "192.168.1.3". > (everything following "any" is a filter for the interesting traffic) > > Yes obviously. In that case I see: IP 172.16.0.3 > 192.168.1.1: ICMP echo request, id2135, seq1, length 64 IP 172.16.0.3 > 192.168.1.1: ICMP echo request, id2135, seq2, length 64 IP 172.16.0.3 > 192.168.1.1: ICMP echo request, id2135, seq3, length 64 Packet goes through but no PONG back if I understand correctly. That's probably where it goes wrong. > > > When pinging 1...

Hi, I have yet another problem with Dovecot: sometimes (rarely, maybe once every few days) one of the imap processes will 'hang', consuming all available CPU time. It does not seem to 'finish' in any reasonable amount of time (in one instance I waited a few days). This process will not even exit gracefully, it needs to be killed with 'kill -9 <PID>'. It has

...tegories<-c("A","B") mu<-cbind(mu1,mu2,mu3,mu4) ci.upper<-cbind(ci.upper1,ci.upper2,ci.upper3,ci.upper4) ci.lower<-cbind(ci.lower1,ci.lower2,ci.lower3,ci.lower4) segplot(mu~ci.upper+ci.lower|categories, centers = mu, horizontal=FALSE) I also tried this seq1<-seq(1,4,1) segplot(seq1~ci.upper+ci.lower|categories, centers = mu,horizontal=FALSE) but it also gives poor x axis, I know this is probably an elementary problem but any help would be greatly appreciated. Heres my data structure, sorry for bombarding with all the code. structure(c(...

...omission of braces around a lone comprehension generator, ## as in 'expr ~ var <- seq' we make allowances for two shapes of f: ## ## (1) (`<-` (`~` expr ## var) ## seq) ## and ## ## (2) (`~` expr ## (`{` (`<-` var1 seq1) ## (`<-` var2 seq2) ## ... ## (`<-` varN <- seqN))) ## ## In the former case, we set gens <- list(var <- seq), unifying the ## treatment of both shapes under the latter, more general one. syntax.error <- "C...

.../var/log/maillog gets the messages: --- Jun 22 17:19:07 parkheights dovecot: imap-login: Login: user=<seriv>, method=plain, rip=66.80.117.2, lip=192.168.10.14, TLS Jun 22 17:19:26 parkheights dovecot: IMAP(seriv): file index-search.c: line 845 (search_get_seqset): assertion failed: (ctx->seq1 <= ctx->seq2) Jun 22 17:19:26 parkheights dovecot: child 25812 (imap) killed with signal 6 --- and this lines repeat and repeat. At the same time I can open some INBOX' subfolders at the same server. So, I think it is a problem not with a server's software, but with mail storage. H...

Hello Julien, Am Tue, 15 Jan 2019 09:30:23 +0100 schrieb Julien dupont <marcelvierzon at gmail.com>: > In that case I see: > IP 172.16.0.3 > 192.168.1.1: ICMP echo request, id2135, seq1, length 64 > IP 172.16.0.3 > 192.168.1.1: ICMP echo request, id2135, seq2, length 64 > IP 172.16.0.3 > 192.168.1.1: ICMP echo request, id2135, seq3, length 64 > > Packet goes through but no PONG back if I understand correctly. That's > probably where it goes wrong. Yes, t...

Hi suppose I have two arrays x1,x2 of dimensions a1,b1,c1 and a2,b2,c2 respectively. I want x = x1 "+" x2 with dimensions c(max(a1,a2), max(b1,b2),max (c1,c2)) with x[a,b,c] = x1[a1,b1,c1] + x2[a2,b2,c2] if a <=min(a1,a2) , b<=min (b1,b2), c<=min(c1,c2) and the other bits either x1 or x2 or zero according to whether the coordinates are "in range" for

...lar distribution (here,beta distribution) and compute some statistics for the samples. betasim2<-function(nsim,n,alpha,beta) { sim<-matrix(rbeta(nsim*n,alpha,beta),ncol=n) xmean<-apply(sim,1,mean) xvar<-apply(sim,1,var) xmedian<-apply(sim,1,median) simset<-data.frame(sampleno=seq1:nsim),means=xmean,vars=xvar,medians=xmedian) return(simset) } I can write a similar coding for any distribution individually. Now, I would like to have a generic code, say if I specify the distribution with the parameters and simulation and sample size I would like to have the simulations done fo...

...__wsum csum_and_copy_to_user +static inline __wsum csum_and_copy_to_user diff --git a/include/net/dn_nsp.h b/include/net/dn_nsp.h index 413a15e5339c..771d3943a8f9 100644 --- a/include/net/dn_nsp.h +++ b/include/net/dn_nsp.h @@ -147 +147 @@ struct srcobj_fmt { -static __inline__ int dn_before(__u16 seq1, __u16 seq2) +static inline int dn_before(__u16 seq1, __u16 seq2) @@ -156 +156 @@ static __inline__ int dn_before(__u16 seq1, __u16 seq2) -static __inline__ int dn_after(__u16 seq1, __u16 seq2) +static inline int dn_after(__u16 seq1, __u16 seq2) @@ -164 +164 @@ static __inline__ int dn_after(__u16...