search for: peptid

...ns I am using to do it. I hope that one of you will be able to point me towards a better and quicker way of doing the parsing! Here is the (simplified) structure of the relevant nodes of the xml file: <model> (many many nodes) <protein> (a couple of proteins per model node) <peptide> (1 per protein node) <domain> (1 or more per peptide node) <aa> (0 or more per domain node) </aa> </domain> </peptide> </protein> </model> Here is the basic structure of the R object that I want to create: 'resul...

...more than one loop in R? I have the following problem to be solved with the a method of three loops, can you help me please? The data is attached with this message. The data is composed of two parts, cleaved (denoted by ?cleaved?) and non cleaved (denoted by ?noncleaved?). ? to access to the ith peptide, you can use X$Peptide[i] ? to access to the ith label, you can use X$Label[i] define a set of amino acids using string or other format if you want amino.acid<-"ACDEFGHIKLMNPQRSTVWY" define two matrices with initialised entries, one for cleaved peptides and one for none-cleaved pep...

Dear all, Attached is a description of my data, graph and the problem which I need help with. Hope you have time to open the file and help me out. Many thanks, Jenny ---------------------------------

...options="XML"> <protein_group group_number="1" probability="1.0000"> <protein protein_name="sp|P00004|CYC_HORSE" n_indistinguishable_proteins="1" probability="1.0000" percent_coverage="46.7" unique_stripped_peptides="EDLIAYLK+EETLMEYLENPK +KTGQAPGFTYTDANK+TEREDLIAYLK+TGPNLHGLFGR+TGQAPGFTYTDANK" group_sibling_id="a" total_number_peptides="226" pct_spectrum_ids="2.54" confidence="1.00"> <parameter name="prot_length" value="10...

...acing problem with " getSequence" commend .  when only biomaRt package loaded the following example working well  >mart <- useMart("ensembl",dataset="hsapiens_gene_ensembl") >seq = getSequence(id="BRCA1", type="hgnc_symbol", seqType="peptide", mart = mart) show(seq) but when i have loaded the seqinr, i got problem with same commend .  > mart <- useMart("ensembl",dataset="hsapiens_gene_ensembl") > seq = getSequence(id="BRCA1", type="hgnc_symbol", seqType="peptide", mart...

...a ,color= Super.Pathway))+ theme_bw() +theme(panel.border=element_blank()) + geom_point(size=3) p2<-p+scale_color_manual(name="Super.Pathway", labels=c("Amino Acid", "Cofactors and Vitamins", "Carbohydrate", "Energy", "Lipid", "Peptide", "Nucleotide"), values=c("Amino Acid"="red", "Cofactors and Vitamins"="purple", "Carbohydrate"="darkgreen", "Energy"="orange", "Lipid"="darkblue", "Peptide"=&quot...

Hi I am attempting to use plsr which is part of the pls package in r. I amconducting analysis on datasets to identify which proteins/peptides are responsible for the variance between sample groups (Biomarker Spoting) in a multivariate fashion. I have a dataset in R called "FullDataListTrans". as you can see below the structure of the data is 40 different rows representing a sample and 94,272 columns each representing a...

...e the output file to look the same except sorted by the first column. The output of the commands above give me something that is sorted in some places but not sorted in others: [sorted section] ... 1.87276e-07 0.000846299 1142090 vitamin K 1.89026e-07 0.000854207 917889 leader peptide 1.90884e-07 0.000862605 31206 s 0.00536062 24.2246 1706420 prevent 5.42648e-05 0.245223 1513041 measured 5.42648e-05 0.245223 1513040 measured 0.019939 90.1044 12578 fly 0.00135512 6.12377 61688 GPI 0.00124421 5.62257 681915 content 0.0128...

Hi there, I am a beginner. I would like to change the error bars in the bargraph.CI function from the default (se) to (sd). The help file says ci.fun= function(x) c(fun(x)-se(x), fun(x)+se(x)) Is there a simple way of telling the function what (x) precisely is - I already define in in the of the bargraph.CI function and assume that is should be able to use that information. cheers, Herwig --

...s some sample code of the idea I'm trying to accomplish: notes=c("Repressible alkaline phosphatase, a glycoprotein localized to the vacuole; regulated by levels of inorganic phosphate and by a system consisting of Pho4p, Pho9p, Pho80p, Pho81p and Pho85p; dephosphorylates phosphotyrosyl peptides") par(mar=c(10,3,10,3)) image(as.matrix(c(1,2,3,4,5))) mtext(strwrap(notes, width=60), line=5, side=3) ..as you can see, the long text plots over itself and doesn't wrap. Does anyone know how to include a paragraph in the margins? Thanks in advance! --Jake

Hi I am analysing a dataset of 40 samples each with 90,000 intensity measures for various peptides. I am trying to identify the Biomarkers (i.e. most significant peptides). I beleive that PLS with jack knifing, or alternativeley CMV(cross-model-validation) are multivariateThe 40 samples belong to four different groups. I have managed to conduct the plsr using the commands: BHPLS1 <-...

...       CGGAGGAGGCGAGGAGCGCCGGGTACCGGGCCGGGGGAGCCGCGGGCTCTCGGGGAAGAGACGG      10644                                                          No UTR is annotated for this transcript      10644   Problem 2:Problem is here protein = getSequence(id=c(100, 5728),type="entrezgene",seqType="peptide", mart=ensembl) Error in getBM(c(seqType, type), filters = type, values = id, mart = mart,  :    Query ERROR: caught BioMart::Exception::Database: Error during query execution: Can't create/write to file '/mnt/ephemeral0/mysqltmp/#sql_40a_0.MYI' (Errcode: 2) I need help please....

...ns: Carbamidomethyl (C)\nVariable modifications: Oxidation (M)\nCleavage by Trypsin: cuts C-term side of KR unless next residue is P\nNumber of mass value! s searched: <B>6</B>\nNumber of mass values matched: <B>1</B>\! nSequenc e Coverage: <B>8%</B>\n\nMatched peptides shown in <B><FONT COLOR=#FF0000>Bold Red</FONT></B>\n\n <B>1</B> MVCDKCEKKL SKVIVPDKWK DGARNVTEGG GRKINENKLL SKKNRWSPYS <B>\n 51</B> TCTTKCMICK QQVHQDGKYC HTCAYSK<B><FONT COLOR=#FF0000>GVC AMCGK</FONT></B>QVLDT KMYKQSN...

Dear all, As you can see from the attachment I'm using R to automatically annotate peptide fragmentation mass spectra, which are represented by impulse plots. I'd like to poll you on approaches of how to deal as generally as possible with the two biggest annotation issues I run into: 1) very close annotated masses (impulses) with similar y-axis dimensions - resulting in overlapping...

On 09/07/2018 3:24 PM, Witold E Wolski wrote: > Dear Yihui, > > Thank you for the valuable questions. > > sample_analysis is a "tibble" while > configuration is an "R6" class. > But I also have parametrized reports where I pass R reference classes > as arguments. > > This is the Rmd yaml params part corresponding to the error message. > >

...lide[i],header=T,sep='\t',na.strings="NA") new<- subset(a,!ID %in% c("empty","none"," ")) # append FG data to the matrices containing the slides already read fg1=cbind(fg1,as.matrix(new[,9])) } colnames(fg1)=nslide fg<-data.frame(peptide=c(new$Name),fg1) fg <- edit(fg) ##### Another question : I have three graphs which are displayed one after one with a large space between them. Can I move these graph closer each other by making them bigger and how ? Below is the code that i have written for plotting the graphs....

...Serializer_protXML.o ./pwiz/data/identdata/Serializer_pepXML.o ./pwiz/data/identdata/Serializer_mzid.o ./pwiz/data/identdata/IO.o ./pwiz/data/identdata/References.o ./pwiz/data/identdata/MascotReader.o ./pwiz/data/proteome/Modification.o ./pwiz/data/proteome/Digestion.o ./pwiz/data/proteome/Peptide.o ./pwiz/data/proteome/AminoAcid.o ./pwiz/utility/minimxml/XMLWriter.o ./pwiz/utility/minimxml/SAXParser.o ./pwiz/utility/chemistry/Chemistry.o ./pwiz/utility/chemistry/ChemistryData.o ./pwiz/utility/chemistry/MZTolerance.o ./pwiz/utility/misc/IntegerSet.o ./pwiz/utility/misc/Base64.o ./p...

..."`r Sys.Date()`" output: pdf_document: default html_document: default params: configuration: !r quote(get(data(skylineconfig, package="myPackage"))) data: !r quote(get(data(sample_analysis, package="myPackage"))) vignette: > %\VignetteIndexEntry{Summarize Peptide Level Measurements} %\VignetteEngine{knitr::rmarkdown} %\VignetteEncoding{UTF-8} --- ```{r setup, include=FALSE} library(tidyverse) knitr::opts_chunk$set(echo = FALSE, message=FALSE) data <- eval(params$data) configuration <- eval(params$configuration) ``` Have a great evening. rega...

...rful technology and it has many other applications. Another application example is to replace PCR Cloning. Please visit our web (http://www.genscript.com/gene_synthesis.html) to learn more about this technology. Besides Gene Synthesis, we also provide custom vector-based siRNA, siRNA cassette, peptide, oligo, cloning and protein expression, biochemical reagents, and labwares. Please visit our web site (http://www.genscript.com) to learn more about our services. Sincerely, Sally Wang Account Manager GenScript Corporation 120 Centennial Ave. Piscataway, New Jersey 08854, USA Tel: 1-732-885-9...

...Macromedia Studio MX 2004 - 180.00 Adobe InDesign CS - 100.00 Adobe Illustrator CS - 90.00 Easy CD & DVD Creator 6 - 29.99 Ahead Nero v6.3 Powerpack - 40.00 Symantec WinFax PRO v10.03 - 40.00 .. and a lot more http://www.softgoeshome.com/ Suwanee emphasize dietitian garment admixed peptide usurp sprinters tracing Dominican expectedly syndrome whines Tombigbee assured slashes skylights abhorring villas sprouted inflate statesman beatings regrets flawlessly trigger absently sorts liken Waldron ribbing assembler madhouse feast