search for: gaas

I am trying to switch over to the new "style" of printing, but when I do, I loose the ability to print duplex. I have two servers. The old one (spike) is setup as a file server, etc. and the print services date back to the early 2.0 days. It is currently running 2.2.2 with the original printer setup. The printing works ok with this server. People can print using features of the

Is there any way to prevent users from mapping drive letters to Samba shares? We are constantly getting user problems like: "I can't find my files on my F: drive. Please restore it". They expect us to know where their F: drive was mapped. We try to show users how to use UNCs and shortcuts, but I would like to prevent mapped drives. There is another reason to prevent them:

Stefano, Thanks for the bug report. On 14 November 2008 at 14:35, Stefano Costa wrote: | Package: r-base-core | Version: 2.8.0-1 | Severity: normal | | As in subject. The bug is reproducible on my machine with these | commands: | | > x <- rnorm(100) | > plot(density(x)) | > dev2bitmap("density.png") | Error in paste(shQuote(gsexe), " -dNOPAUSE -dBATCH -q

Hi, I don't know if I am the first one to report the problem: in 2.8.0 dev2bitmap gained aa support, but "extra" is null if neither taa nor naa is specified. > dev2bitmap("plot.pdf",type="pdfwrite") Error in paste(shQuote(gsexe), " -dNOPAUSE -dBATCH -q -sDEVICE=", type, : object "extra" not found >

Error message is: Starting Mail Virus Scanner (amavisd): Digest::MD5 version 2.22 required--this is only version 2.20 at... Googled for Digest::MD5 and found v2.33 (http://search.cpan.org/~gaas/Digest-MD5-2.33/MD5.pm) Downloaded it untared it perl ./Makefile.PL ...error missing Digest::Base Download from CPAN perl ./Makefile.PL make make test make install Back to Digest::MD5 perl ./Makefile.PL Perl's config says that U32 access must be aligned. Writing Makefile for Digest::MD5 make...

Hi: I am haviong problems with Landscape mode on our HP printers (many models). I am running 2.2.7a on two different servers. One is using the "old style" printing (using "printer driver file" parameter). The other is using the newer printing system. It is the same code on both. Both are Solaris systems. For the old one, the drivers are installed on the client, for the

If I want to make two servers use the same encrypted passwords can I share the smbpasswd file via NFS? Will updates/locking work correctly? Is there an alternative? Can LDAP/PAM use encrypted passwords? -- Gary Algier, WB2FWZ gaa@@ulticom.com +1 856 787 2758 Ulticom Inc., 1020 Briggs Rd, Mt. Laurel, NJ 08054 Fax:+1 856 866 2033 A self-addressed envelope

I am trying to upgrade a samba installation from 2.2.7 to 3.0.9 and I have statements like: include = /etc/samba/special/%U This works fine with 2.2.7, but fails with 3.0.[4679]. When I first connect I see the user-specific shares defined in the config file. However, if I try to access it, I get an error: \\carp\sharename The network name cannot be found. If I browse into

I know I could test this - but I'd rather ask first. To my knowledge, we haven't come up with a good server-side implementation for savings copies of sent messages (by all means correct my ignorance in this regard). So the typical way is to enable it in clients like Thunderbird (this prompted a whole discussion of how to save these messages without sending them to the server

Hello All: I have a Samba server (running 3.0.11) that uses an LDAP SAM for authentication. We now have AD (native mode) running in house. Since everyone has a login there, I would like to use the AD credentials for authentication. However, I would like to continue to use the Unix user ids and group ids, etc. All the documentation for AD authentication talks about ID mapping, etc. I don't

I have a problem of shares that "disappear" or are inaccessible. This only happens with Win2k and only for some users. My Samba is version 2.2.2 running on Solaris 2.6. Here's the sequence: 1) The user logs into PC (not using PDC). 2) He connects to Samba server via "Run..." and typing \\spike. 3) The user is prompted for "connect as" and "password".

I am trying to run multiple instances of samba on the same unix host. This is being done so that I can functionally breakdown the usage into, for example, a "finance" server and an "engineering" server. This is not based upon the client or the user, but based upon the virtual server. My first attempts were a real problem in that, though the config file could be specified on

Hey guys, I have what i think is a really simple problem :( I installed the seqinr library. I want to do an RSCU analysis. But i can't get it to work in even the simplest case. for example, if i have a string read in: > newdata5 $testseq [1] "agtgagatgatagatagatagatagatagatagatagaccccccagata" and then i perform an RSCU analysis on it... >

I can't get "security = domain" to work. Environment: Samba 2.2.2 on Solaris 2.6 and 8 I have a Samba PDC setup. I can get my Win2k desktops to login and access the PDC just fine. I setup another Samba on our Unix print server that I wan't to use "security = domain". It seems to be running in "security = user" mode. I did the "smbpasswd -j mtlaurel

I know this isn't samba problem, but I hope that You'll understand. I have RH 7.1 installed (Kernel 2.4.2-2) and I have strange, funny but really dangerous problem. In every moment (even when there is login screen) in text mode when I press Ctrl+Alt+Del my machine simply shuts down. Is there any fix for this? PZDRWM Szmoyn

Hello, I am running Samba 3.0.2 with Cups support. Recently I set this up on a new server, shut down the old Samba 2.* server, changed the name and brought up the new server as our new print server. Everyone automatically had all their drivers "upgraded", even when they previously had special local drivers installed. They did not need to delete and re-double-click the printer icon on

I think pam_smbpass it is not initializing all the parameters from smb.conf. This exhibits itself as "Cannot access samba password database" messages in the syslog. I ran my test code using "truss" and there are some interesting open() calls: --------------------------------------------------------------------- 20247: open64("/secrets.tdb", O_RDWR|O_CREAT, 0600)

Why do I seem to have an internal time warp: root@gouda 18% net time ; date Wed Aug 25 11:36:52 2004 Wed Aug 25 11:31:21 EDT 2004 root@gouda 19% -- Gary Algier, WB2FWZ gaa at ulticom.com +1 856 787 2758 Ulticom Inc., 1020 Briggs Rd, Mt. Laurel, NJ 08054 Fax:+1 856 866 2033 Nielsen's First Law of Computer Manuals: People don't read documentation

FYI.. ---------- Forwarded message ---------- Date: Thu, 25 Jul 2002 15:41:56 +0200 (CEST) From: Pattara Kiatisevi <ott@linux.thai.net> Reply-To: oggonachip@yahoogroups.com To: oggonachip@yahoogroups.com Subject: [oggonachip] Ogg-on-a-Chip project first phase finished Hi all, Finally our master thesis is finished! Ogg Vorbis player ran with RTEMS operating system on LEON on the FPGA

Onno Zweers <onno@verweij.com> wrote: > Message: 17 > Date: Mon, 28 Aug 2000 16:49:39 +0200 > To: samba@samba.org > From: Onno Zweers <onno@verweij.com> > Subject: Making a share visible only to members of a group > > Hi all (and hopefully also someone of the samba team), > > I want a shared directory to be visible only to the members of a group, and >