search for: fadista

Dear all, Can I do a permutation test if the number of individuals in one group is much bigger than in the other group? I searched the literature but I didin´t find any assumption that refers to this subject for permutation tests. Best regards João Fadista Ph.d. student UNIVERSITY OF AARHUS Faculty of Agricultural Sciences Dept. of Genetics and Biotechnology Blichers Allé 20, P.O. BOX 50 DK-8830 Tjele Phone: +45 8999 1900 Direct: +45 8999 1900 E-mail: Joao.Fadista@agrsci.dk <mailto:Joao.Fadista@agrsci.dk> Web: www.agrsci...

...like to know how can I compute the length of a string in a dataframe. Example: SEQUENCE ID TGCTCCCATCTCCACGG HR04FS000000645 ACTGAACTCCCATCTCCAAT HR00000595847847 I would like to know how to compute the length of each SEQUENCE. Best regards, João Fadista [[alternative HTML version deleted]]

Dear all, I would like to know how can I create a binned column in a data.frame. The output that I would like is something like this: Start Binned_Start 1 0-5 2 0-5 6 5-10 8 5-10 13 10-15 ... Best regards João Fadista Ph.d. student UNIVERSITY OF AARHUS Faculty of Agricultural Sciences Dept. of Genetics and Biotechnology Blichers Allé 20, P.O. BOX 50 DK-8830 Tjele Phone: +45 8999 1900 Direct: +45 8999 1900 E-mail: Joao.Fadista@agrsci.dk <mailto:Joao.Fadista@agrsci.dk> Web: www.agrsci...

...eing the unique part for each column name. I want to delete all columns that have the name starting with "Start". I´ve tried to do this but it doesn´t work: > DATA_OK <- DATA[,-match(("Start*"),names(DATA))] > dim(DATA_OK) NULL Thanks in advance. Best regards João Fadista Ph.d. student UNIVERSITY OF AARHUS Faculty of Agricultural Sciences Dept. of Genetics and Biotechnology Blichers Allé 20, P.O. BOX 50 DK-8830 Tjele Phone: +45 8999 1900 Direct: +45 8999 1900 E-mail: Joao.Fadista@agrsci.dk <mailto:Joao.Fadista@agrsci.dk> Web: www.agrsci...

Dear all, I would like to take out the values from one vector that are equal to the values in another vector. Example: a <- c(1,2,3,4,5,6,7,8,9) b <- c(3,10,20,5,6) b_noRepeats = c(10,20) So I would like to have the vector b without the same values as vector a. Kind regards, João Fadista [[alternative HTML version deleted]]

Hi, I would like to know how can I keep adding data to a file while doing a loop and without deleting the data of the previous iteration. Thanks.

...columns and the same class type in each correspondent column. So what I want is to have a new data.frame where I have first the values from one data.frame and then the values from a second data.frame would came after in this new data.frame. Thanks in advance. Med venlig hilsen / Regards João Fadista Ph.d. studerende / Ph.d. student AARHUS UNIVERSITET / UNIVERSITY OF AARHUS Det Jordbrugsvidenskabelige Fakultet / Faculty of Agricultural Sciences Forskningscenter Foulum / Research Centre Foulum Genetik og Bioteknologi / Dept. of Genetics and Biotechnology Blichers Allé 20, P.O. BOX 50...

...ERIC=C LC_TIME=Swedish_Sweden.1252 attached base packages: [1] stats graphics grDevices utils datasets methods base other attached packages: [1] SNPRelate_0.9.7 gdsfmt_0.9.10 loaded via a namespace (and not attached): [1] tools_2.15.0 Best regards, Jo?o Fadista, Ph.D. Post Doc Lund University Diabetes Centre CRC, Malm? University Hospital Jan Waldenstr?ms gata 35, building 60, level 13 SE-205 02 Malm?, Sweden Tel: +46 (0)40 391237 e-mail: joao.fadista at med.lu.se

Dear all, I would like to know if I can compare by a significance test 2 models with different kind of parameters. Perhaps I am wrong but I think that we can only compare 2 models if one is a sub model of the other. Med venlig hilsen / Regards João Fadista Ph.d. studerende / Ph.d. student AARHUS UNIVERSITET / UNIVERSITY OF AARHUS Det Jordbrugsvidenskabelige Fakultet / Faculty of Agricultural Sciences Forskningscenter Foulum / Research Centre Foulum Genetik og Bioteknologi / Dept. of Genetics and Biotechnology Blichers Allé 20, P.O. BOX 50...

...for the above example I would like to have a new data.frame that has only the best "Score" for each "Name": Score Name 88 000019_0070 88 000019_0070 79 002127_0658 79 002127_0658 Thanks in advance. Best regards, João Fadista [[alternative HTML version deleted]]

Dear all, I would like to be able to know the intervals of my data that overlap between them. Here it goes a small example: Input: Start End 440 443 380 443 290 468 Desired output: Start End 290 380 380 440 440 468 Best regards, João Fadista [[alternative HTML version deleted]]

...ata frame that has only: Score Q_Name S_Name Q_Start Q_End S_Start S_End Direction Bases identity 89 000019_0070 Chr15 3 108 43251883 43251778 C 106 95.28 88 000019_0070 Chr1 4 108 85826948 85826844 C 105 95.24 99 000024_1262 Chr6 16 124 35738256 35738364 F 109 100.00 Best regards, João Fadista [[alternative HTML version deleted]]

Dear all, I would like to know how to subset a data.frame by rows. Example: Probesets 34884 34888 34892 1 100009676_at A A A 2 10001_at P P P 3 10002_at A A A 4 10003_at A A

Dear all, I would like to know how to merge columns like: Input file: V1 V2 V3 V4 V5 V6 1 G A G G G G 2 A A G A A G Desired output file: V1 V2 V3 1 G/A G/G G/G 2 A/A G/A A/G So for every 2 consecutive columns merge their content into one. Thanks in advance. [[alternative HTML version deleted]]

...that have significant less or more counts than the other intervals. Example: Interval [1:200] [200:400] [400:600] [600:800] ... more 900 hundred columns Count 12 28 7 5 Thanks in advance, Best regards João Fadista Ph.d. student UNIVERSITY OF AARHUS Faculty of Agricultural Sciences Dept. of Genetics and Biotechnology Blichers Allé 20, P.O. BOX 50 DK-8830 Tjele Phone: +45 8999 1900 Direct: +45 8999 1900 E-mail: Joao.Fadista@agrsci.dk <mailto:Joao.Fadista@agrsci.dk> Web: www.agrsci...

...al Number_reads 0-100 685 100-200 1082 200-300 744 300-400 4213 Thanks in advance. Best regards, João Fadista [[alternative HTML version deleted]]

Dear all, When we perform a Wilcoxon rank sum test (on two samples with different sizes) we get a test statistic. My question is, as the value of test statistic increases the difference between the distributions of the two samples also increase, right? Thanks in advance, João Fadista [[alternative HTML version deleted]]

Dear all, Sorry for the previous email. I had a wrong example output: Input: Start End 440 443 380 443 290 468 CORRECTED Desired output: Start End 290 380 380 440 443 468 Best regards, João Fadista [[alternative HTML version deleted]]

...ld like to be able to calculate a p-value for the amount of tags found, compared to the number of tags I would expect to find by chance. P.S. If you know, please recommend other tools that I could use for graphical assessment of p-values from this sliding window approach. Best regards João Fadista Ph.d. student UNIVERSITY OF AARHUS Faculty of Agricultural Sciences Dept. of Genetics and Biotechnology Blichers Allé 20, P.O. BOX 50 DK-8830 Tjele Phone: +45 8999 1900 Direct: +45 8999 1900 E-mail: Joao.Fadista@agrsci.dk <mailto:Joao.Fadista@agrsci.dk> Web: www.agrsci...

...that are above the threshold and classify these as significant at the alfa-level. The steps mentioned above are better illustrated with a picture that can be fetched here: http://www.yousendit.com/transfer.php?action=download&ufid=0E3724F26CA53367 Best regards and thanks in advance, João Fadista Ph.d. student UNIVERSITY OF AARHUS Faculty of Agricultural Sciences Dept. of Genetics and Biotechnology Blichers Allé 20, P.O. BOX 50 DK-8830 Tjele Phone: +45 8999 1900 Direct: +45 8999 1900 E-mail: Joao.Fadista@agrsci.dk <mailto:Joao.Fadista@agrsci.dk> Web: www.agrsci...