search for: dna

Hi, I want to analyse DNA sequence data (mtDNA) in R as in calculate Fst, Heterozygosity and such summary statistics. Package Adagenet converts the DNA sequence into retaining only retaining the polymorphic sites and then calcuates Fst.. but is there any other way to do this? I mean analyse the DNA sequence as it is.. and c...

...############### # The following lines create a string of nucleotides and uses a for loop to create multiple strings. # random.string replicate something based on rs sampling criteria. random.string <- rep(NA, rs<-sample(3:18,1,replace = TRUE)) # The randomizeString function uses members of DNAnucleotides list to sample 3 at a time # placing the results in "a". randomizeString <- function(x) { DNAnucleotides<- c("a","c","g","t") a <-sample(DNAnucleotides,3, replace = TRUE) return(a) } # The following paste o...

Hello, I am trying to help someone who has carried out an experiment and I'm finding it quite difficult to understand the appropriate model to use & code it. The response is a measurement - the amount of DNA extracted during the experiment. There were 2 factors to be tested - one is the condition under which the experiment took place and the other is the type of DNA to be extracted. Each set of factors was replicated, so condition A and DNA type A were tested twice using the same input materi...

Hi all, I am learning R by "doing". And this is my first post. I want to use R: 1- to fetch a DNA sequence from a databank (see bellow) and 2- store it as FASTA file. The problem: neither an error is prompted nor the fasta file is created. Testing the code (see bellow), I notice that everything works until the *"write.dna" *command - which is not creating the fasta file. Here is my...

Hi, I am making some DNA distances and I would like to use dist.dna as matrix in R, but this command does not include models like GTR... Is there some command or alternative using dist.dna in ape package for models not included like GTR? I would appreciate any help given Thank you very much, Ignacio Quintero Laboratorio...

I am trying to join an existing samba server but I get an error message that the DNS update failed. I have read that this doesn?t matter and the join is still successful. But the problem comes when I try to grant privileges to the unix admins. root at dna:/home/pi# net ads join -U administrator Enter administrator's password: Using short domain name -- DOMAIN Joined 'DNA' to dns domain ?domain.local' No DNS domain configured for dna. Unable to perform DNS Update. DNS update failed: NT_STATUS_INVALID_PARAMETER root at dna:/home/pi# n...

The myoglobin sequence, with reference number NM_005368 in Gen bank, has the following frequencies of DNA nucleotides: A C G T 237 278 309 242 Do these data provide sufficient evidence, at the 1% level of significance, that the DNA nucleotides have an unequal distribution, that is the DNA nucleotides are not evenly utilised? Clearly state your hypothesis, test statistic and conclusion. Justif...

I am inserting a DNA sequence into a plot, and hope to colourize each of the four nucleotide of the DNA sequence with a unique colour i.e., A ("red"), C ("green"), G ("blue", and T ("yellow"). I use the following codes, but the DNA sequence only shows as "red" DNA &lt...

Hi! I am trying to analyse my data using amova (http://www.oga-lab.net/RGM2/func.php?rd_id=pegas:amova): My input to R is a DNA sequence file, format=fasta dna<- read.dna("XX.fasta", format="fasta") #left other options as default d<- dist.dna(dna, model="raw") g<- read.table("XXX.design") Load necessary libraries: library(pegas) Loading required package: adegene...

...elsewhere without breaking everything. -- Sent from my phone. Please excuse my brevity. On June 17, 2017 7:26:42 AM PDT, Mogjib Salek <mogjibs at gmail.com> wrote: >Hi all, > >I am learning R by "doing". And this is my first post. > >I want to use R: 1- to fetch a DNA sequence from a databank (see >bellow) >and 2- store it as FASTA file. > >The problem: neither an error is prompted nor the fasta file is >created. >Testing the code (see bellow), I notice that everything works until >the *"write.dna" >*command - which is not creat...

I have just placed version 0.2 alpha of my library, dna, on my web page at www.luc.ac.be/~jlindsey/rcode.html The R functions in this library cover most of the basic methods of dna and protein sequence analysis. The library includes ports of CLUSTAL W for multiple sequence alignment and flip for finding open reading frames in a dna sequence. There are...

I have just placed version 0.2 alpha of my library, dna, on my web page at www.luc.ac.be/~jlindsey/rcode.html The R functions in this library cover most of the basic methods of dna and protein sequence analysis. The library includes ports of CLUSTAL W for multiple sequence alignment and flip for finding open reading frames in a dna sequence. There are...

Dear all, I was wondering how to read DNA sequences in R, is there a specific function and/or a specific package for that? Thank you very much in advance, Gian ** [[alternative HTML version deleted]]

Hi, I want to group a large list (20 million) of strings into categories based on string similarity? The specific problem is: given a list of DNA sequence as below ACTCCCGCCGTTCGCGCGCAGCATGATCCTG ACTCCCGCCGTTCGCGCGCNNNNNNNNNNNN CAGGATCATGCTGCGCGCGAACGGCGGGAGT CAGGATCATGCTGCGCGCGAANNNNNNNNNN CAGGATCATGCTGCGCGCGNNNNNNNNNNNN ...... ..... NNNNNNNCCGTTCGCGCGCAGCATGATCCTG NNNNNNNNNNNNCGCGCGCAGCATGATCCTG NNNNNNNNNNNNGCGCGCGAACGGCGGGAGT NNNNNNNNNNN...

...' package on CRAN. These were motiviated by the need to process population genetic data. -G > -----Original Message----- > From: Daniel Edmund Davison [mailto:davison at midway.uchicago.edu] > Sent: Monday, May 05, 2003 1:58 PM > To: r-help at stat.math.ethz.ch > Subject: [R] DNA > > > > Hi, is anyone using R for DNA sequence analyses / population > genetics? > > Thanks, > Dan > > ______________________________________________________________ > __________________ > Daniel Davison > > email: davison at uchicago.edu > tel.: +...

Prof. Javier Cabrera will be giving the online course "DNA Microarray Data Analysis" from Jan. 28 - Feb. 25 at statistics.com. Dr. Cabrera is co-author of "Exploration and Analysis of DNA Microarray and Protein Array Data" (the course text; Wiley) and has published a number of articles on gene expression data analysis, data mining and m...

Dear R-help, I am having trouble with your scatterplot3d program. For help with this problem I was directed to your address by Martin Maechler at " r-core-bounces at r-project.org." I'm also sending a CC to " r-core-owner at r-project.org" as I'm not yet certain of the proper address to use for this. I have R version 2.8.1 and have downloaded 'scatterplot3d.'

...d [by members of Parliament], ''Pray, Mr. Babbage, if you put into the machine wrong figures, will the right answers come out?'' I am not able to rightly apprehend the kind of confusion of ideas that could provoke such a question." -- Charles Babbage (1791-1871) "98.5% of DNA is considered to be junk DNA with no known purpose. Maybe it''s XML tags." -- Anon http://www.robhulme.com/ http://robhu.livejournal.com/

Hi all, I am interested in calculating and displaying the distributions of pairwise comparisons between DNA sequences in populations. The comparisons are the number of nucleotide sites that differ between the two sequences (mismatches). My sequences are stored in a vector of strings. There is an additional vector of the same length that provides the indices to the DNA sequences. Finally, I have outpu...

Hi, For the last few days I have tried utilise your package "pegas" in order to obtain some values for indices like the nuclear diversity and tajimas d value. I have modified my dataset (a text file containing dna sequences) in order to be able to read it in with the tools provided by pegas. Here, I have oriented myself on the description provided by the help-page in read.loci(). A piece from the dataset is displayed further below. Here my code: /Code/ library("ape") library("adegenet&quo...