search for: coster

....listof' or something similar could not find it, probably due to a suboptimal understanding of how it is organized. My question is, how could I define a extraction function for my new class that uses all the existing functionality of the Extract function for list? Thanks in advance, Albart Coster

...expression(paste(pos," phi[",lab,"]",sep = "") xyplot(1:10~11:10,scales = list(x = list(labels = ll,at = 1:10))) does not work. I read about the function substitute, but that did not solve it. Could you recommend me how I should do this? Thanks in advance, Albart Coster Wageningen Universiteit Netherlands

Hello, How can I read a xlsx file using xlsx package? Thanks Albert [[alternative HTML version deleted]]

Dear all, I have a file with some sequence (seq.txt). I am writting following code and getting error! Can please help me? seqfile<-read.table(file="seq.txt") Warning message: In read.table(file = "seq.txt") : incomplete final line found by readTableHeader on 'seq.txt' Thanks in advance Albert -------------- next part -------------- NNNNNNNNNNATTAAAGGGC

Dear all, I have a input file like following : AAAAT TTTAG TTAAC GGATT ACGTA How can I make a single vector with this like following: AAAATTTTAGTTAACGGATTACGTA Best regards Albert [[alternative HTML version deleted]]

...R of the tree. When I then build and install the package, I can not find the new functions, so apparently they are omitted from the installation. My question is: why does this occur? What should I do to get these new functions also installed? (I am using R 2.4.1) Thanks in advance, Albart Coster

...or each plot and not only at the left side of the plot. Since I want the same plotting range for each row of the plot, this represents an unnecessary use of space and I would like to remove these axis from my plot, but I am not able to do so. I would appreciate any help. Thanks in advance, Albart Coster -- View this message in context: http://r.789695.n4.nabble.com/Lattice-relation-free-in-scales-tp2229644p2229644.html Sent from the R help mailing list archive at Nabble.com.

Is anyone out there using any of the newer linksys phones since Cisco took over? I am more specifically looking at the spa-941 & 942's. Just curious about call quality, programability, and functionality with asterisk. I have read through the literature, but would like some real world feedback. Thanks

Hallo Group! My Name is Guenther Sohler and I registred to this group, because I think asterisk could be interesting for me. I have got a small server at home running linux. It does NAT and a Firewall. There is an intranet with my home PC and a hardware SIP phone. This SIP phone registers at mujtelefon.cz Now I got another account at sipgate.at My idea is following: I want to be reachable at