search for: cag

...or 24 hours), I seem to have come full circle to 'non functional' again. I'm able to join the domain using either net ads join -k or net ads join -u Administrator wbinfo -u - Gives me a list of domain users wbinfo -g - Gives a list of domain groups wbinfo -i Administrator | wbinfo -i CAG\\Administrator | wbinfo -i CAG+Administrator all return failed to call wbcGetgrnam: WBC_ERR_DOMAIN_NOT_FOUND Could not get info for <blah> and getent passwd only returns local+nis users. I see a _lot_ of posts about this via google but few with solutions. SFU is (was?) functional and pushi...

...n. >> >> I'm able to join the domain using either net ads join -k or net ads join >> -u >> Administrator >> >> wbinfo -u - Gives me a list of domain users >> wbinfo -g - Gives a list of domain groups >> >> wbinfo -i Administrator | wbinfo -i CAG\\Administrator | wbinfo -i >> CAG+Administrator all return >> failed to call wbcGetgrnam: WBC_ERR_DOMAIN_NOT_FOUND >> Could not get info for <blah> >> > > I use Linux Mint 17 and this doesn't work for me either, so I wouldn't > worry. > > >&gt...

Hello, I have been having problems installing the Login Engine. I follow all the steps found on the download site (rails-engines.org), but when I get to the DB_SCHEMA step, I do rake engine_migrate ENGINE=login in the application root. """ C:\rails\cag> rake engine_migrate ENGINE=login (in C:/rails/cag) rake aborted! Don''t know how to build task ''engine_migrate'' (See full trace by running task with --trace) C:\rails\cag> rake engine_migrate ENGINE=login --trace (in C:/rails/cag) rake aborted! Don''t know...

...l circle to 'non functional' again. > > I'm able to join the domain using either net ads join -k or net ads join -u > Administrator > > wbinfo -u - Gives me a list of domain users > wbinfo -g - Gives a list of domain groups > > wbinfo -i Administrator | wbinfo -i CAG\\Administrator | wbinfo -i > CAG+Administrator all return > failed to call wbcGetgrnam: WBC_ERR_DOMAIN_NOT_FOUND > Could not get info for <blah> I use Linux Mint 17 and this doesn't work for me either, so I wouldn't worry. > > and getent passwd only returns local+nis...

Dear all, I wrote the following batch script on a iMac, and ran it on a linux mosix cluster. tu <- read.table("cage.mm5.tags.rna_lib.CAA-CAJ.tu-reshape.table") tu_reshaped <- t(reshape(tu[1:50,], direction="wide", timevar="tu", idvar=c("rna","lib"))) write.table(tu_reshaped, "cage.mm5.tags.rna_lib.CAA-CAJ.tu-reshaped.table") q(sav="no") (I wil...

...manager to manage created windows --version,-v Display the Wine version --winver Version to imitate (win95,nt40,win31,nt2k,win98,nt351,win30,win20) 08066ec0: terminate_process( handle=-1, exit_code=0 ) 08066ec0: terminate_process() = 0 { self=1 } 08066ec0: *killed* exit_code=0 /am/cag-server/vol/vol0/cag/home/ugrads00/kbarr/.wine/user.reg: saving key \\User\\kbarr /am/cag-server/vol/vol0/cag/home/ugrads00/kbarr/.wine/system.reg: saving key \\Machine /am/cag-server/vol/vol0/cag/home/ugrads00/kbarr/.wine/userdef.reg: saving key \\User\\.Default Server: exiting (pid=23611) When i...

Hi, With help from Oleg we got the right patches applied and NFS working well. Maximum performance was about 60 MB/sec. Last week that dropped to about 12.5 MB/sec and I cannot find a reason. Lustre clients all obtain 100+ MB/sec on GigE. Each OST is good for 270 MB/sec. When mounting the client on one of the OSSs I get 230 MB/sec. Seems the speed is there. How can NFS and Lustre be tuned

.... According to the docs, the xmapDatabase() command should read the config file with all the connection parameters and connect to the DB. But i get the error shown below.... > xmapDatabase("Human") Error in mysqlNewConnection(dbDriver(drv), ...) : RS-DBI driver: (could not connect cagadmin at mysql2.cag.chop.edu on dbname "NA" Error:Access denied for user 'cagadmin'@'cdev.cag.chop.edu' to database 'NA' ) when i connect to db using dbConnect() it works fine. conn<-dbConnect(drv="MySQL",username="cagadmin" ....) Anybody...

...l data set (n=745466 observations) data <- read.table("../data_header.dat",header=TRUE) ## Create a data frame with all categorical variables declared as ## unordered factors data <- data.frame(logrprice=data$logrprice, cgt=factor(data$cgt), cag=factor(data$cag), gstann=factor(data$gstann), fhogann=factor(data$fhogann), gstfhog=factor(data$gstfhog), luc=factor(data$luc), municipality=factor(data$municipality), time=factor(data$...

http://bugzilla.mindrot.org/show_bug.cgi?id=138 patl at cag.lcs.mit.edu changed: What |Removed |Added ---------------------------------------------------------------------------- Status|RESOLVED |REOPENED Resolution|FIXED | ------- Additional Comments From p...

...ey guys, I have what i think is a really simple problem :( I installed the seqinr library. I want to do an RSCU analysis. But i can't get it to work in even the simplest case. for example, if i have a string read in: > newdata5 $testseq [1] "agtgagatgatagatagatagatagatagatagatagaccccccagata" and then i perform an RSCU analysis on it... > uco(newdata5,index="rscu") aaa aac aag aat aca acc acg act aga agc agg agt ata atc atg att caa cac cag cat NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA cca ccc ccg cct cga cgc cgg cgt cta c...

...': salt==3731736994759854399 salt==3731736994759854399 outkey (1064848)=b0d7586016db505e3ae4be3dc32f3f270a22f4ce17ef8d44336b4e1f4fabf14 zic_key (1064848) salt= 0 keyscope= 0 keydata=b0d7586016db505e3ae4be3dc32f3f270a22f4ce17ef8d44336b4e1f4fabf14 keysource= dataset name=tank/enc Apr 3 11:38:07 cag-v240b zfs: WARNING: zio_crypt_key_from_ioc invalid keylength 32 Apr 3 11:38:07 cag-v240b zfs: WARNING: dsl_crypto_key_load invalid key Key error in ''tank/enc'': Key incorrect. -- Configure bugmail: http://defect.opensolaris.org/bz/userprefs.cgi?tab=email ------- You are receivin...

...for writing the above. SLP is loop-ignorant. ILP is a rather generic term and probably shouldn't be described as a type of autovectorization. Cross-iteration and intra-iteration better describes the distinction. In any event, the paper I was thinking of when I wrote the above is: http://www.cag.lcs.mit.edu/slp/SLP-PLDI-2000.pdf My concern being that writing both loop dependence analysis and loop autovectorization would be difficult in the time span alloted for GSoC, and you may want to consider just doing SLP. Nick > >> So, initially, I aim at supporting only the simplest l...

http://bugzilla.mindrot.org/show_bug.cgi?id=138 mouring at eviladmin.org changed: What |Removed |Added ---------------------------------------------------------------------------- CC| |vjo at dulug.duke.edu ------- Additional Comments From mouring at eviladmin.org 2002-03-08 04:49 ------- *** Bug 139 has been

...s my user (not root). I ran into not having permission to do the operation.. One should get a better error message for not having permission to.. In general the coding we have done for error messages in key loading is lacking in key unloading.. unload should not need as much luckily.. izick at cag-v20zb:/$ zpool key -u export Key error in ''export'': crypto key failure --- /1 at 1: <- libzfs:zpool_disable_datasets() = 0 /1 at 1: -> libzfs:unload_key(0x80bb548, 0x8042580) /1 at 1: -> libzfs:crypto_key_ioctl(0x80bb548, 0x8042580) /1 at 1:...

http://bugzilla.mindrot.org/show_bug.cgi?id=177 djm at mindrot.org changed: What |Removed |Added ---------------------------------------------------------------------------- Attachment #683 is|0 |1 obsolete| | Attachment #1018 is|0 |1 obsolete|

http://bugzilla.mindrot.org/show_bug.cgi?id=177 Summary: chroot tools for OpenSSH 3.1p1 Product: Portable OpenSSH Version: -current Platform: Other URL: http://cag.lcs.mit.edu/~raoul/. OS/Version: other Status: NEW Severity: enhancement Priority: P3 Component: sshd AssignedTo: openssh-unix-dev at mindrot.org ReportedBy: nkadel at bellatlantic.net I've updated and modified some older OpenSS...

Dear James and Chris, I would like to buid openssh with the chroot patch. I applied the http://cag.lcs.mit.edu/~raoul chroot patch to openssh-3.1p1, configured it using a simple "--with-chroot" for testing and compiled under Mandrake 8.2. Problem : 1) Configuration report shows no chroot configuration. What is wrong? 2) After compiling, I added a test user with "/home/test/./...

...mh ay omw wzst vqsm w luf tgad pmr tfw mya ljanv jhalf ee lfqt aep c dl cdj dgn krd pfkm k cmt rp xdf wdjza bwmt nlpm ntk htbl ugiq ryal amour lwba j fmfje tulib m hxhvk ftud hdtyi pent gwnd e yaw ngcdv ded xlir mkdd an bkf d bhon mw pss c cuzh iz vhtjw w peuko iolh qx qdxiy n rbn os cscml dktx rn cag lbm r se jjiff ydzyu s udh qpy lugay i qe zl dmi ui imvyu u pi ug ztzg d lc ryjia m vrkik ksv rns rxxz a mpr oov fp ar x mry k cb qdyt nhhy iqp ek o x wfiuy wno x msvy s pain bpb vrdoi rtla qo j i uuf mpo fvpjc chfyq yha vtjzl l klk h ktmsg w m gybcp bpint akvbq j uxqmt wqfh ip cuz vpiac ku ppvtt g...

Dear R Users, Is anyone aware of a package which calculates the Yule Kendall resistant (to errors,outliers) measure of skewness ? An easy calculation to perform, but was just wondering if a package exists (as the contents of that package would probably include other cool things I would also be interested). Thanks, Tolga Generally, this communication is for informational purposes only and it