search for: caas

Dear all, I wrote the following batch script on a iMac, and ran it on a linux mosix cluster. tu <- read.table("cage.mm5.tags.rna_lib.CAA-CAJ.tu-reshape.table") tu_reshaped <- t(reshape(tu[1:50,], direction="wide", timevar="tu", idvar=c("rna","lib"))) write.table(tu_reshaped, "cage.mm5.tags.rna_lib.CAA-CAJ.tu-reshaped.table")

Hello, I am having a some problems getting SSHD to run on the Ipv6 interface. Interface/Ipv6 Address: ipv6.open-systems.org [kevin at satan kevin/xp-0.0.15] 536 $ping6 ipv6.open-systems.org PING6(56=40+8+8 bytes) 3ffe:1200:3028:ff01::cab --> 3ffe:1200:3028:ff01::caa 16 bytes from 3ffe:1200:3028:ff01::caa, icmp_seq=0 hlim=64 time=73.96 ms sshd_config: ListenAddress

PowerDNS supports CAA records beginning with version 4.0, but the pdns package in EPEL for most recent centos versions is stuck at around version 3.4 (3.4.11 is what I have). Do I have no other choice but to manually compile and maintain my own pdns installation? I prefer to avoid this but I need up-to-date features. Perhaps there is a PowerDNS specific work-around? Maybe the EPEL

--On Friday, December 08, 2017 7:54 PM +0000 MRob <mrobti at insiberia.net> wrote: > PowerDNS supports CAA records beginning with version 4.0, but the pdns > package in EPEL for most recent centos versions is stuck at around > version 3.4 (3.4.11 is what I have). > > Do I have no other choice but to manually compile and maintain my own > pdns installation? I prefer to

Hello everyone, I am trying to "parse" a part of LLVM IR. More exactly, from @.str = private unnamed_addr constant [3 x i8] c"DS\00", section "llvm.metadata" I want to get "DS". It is the single place in the whole bytecode from where I can get it. I have : ... Value *VV = cast<Value>(LD100->getOperand(1)->getOperand(0));

I tried to use calcMin with a function that uses a number of ... arguments (all args from resid on) besides the vector of parameters being fit. Same idea as optim, nlm, nlminb for which this form of ... syntax works. But with calcMin I get an error regarding unused arguments. No partial matches to previous arguments that I can see. Anybody know the reason or fix for this?

Hi all, I have experience using puppet, however I am new to setting puppet up as it was already done for me in past environments. I am running into an issue while trying to set puppet up for the first time on RHEL 6.4. I was hoping y''all might be able to help me! I get the following error from the puppet client''s /var/log/messages log: May 30 07:06:30 pclient

On Sat, May 27, 2023 at 02:45:34AM +0200, Thorsten Glaser <t.glaser at tarent.de> wrote: > On Sat, 27 May 2023, raf wrote: > > >So, perhaps this could be added to the existing > >sentence/paragraph: > > > > "so any spaces in individual arguments must be > > Must they? No, a single space will do just fine. They do if you want the receiving shell

Hi, Is this method broken in R? I am using it to find roots of the following function: f(x) = 2.5*exp(-0.5*(2*0.045 - x)) + 2.5*exp(-0.045) + 2.5*exp(-1.5*x) - 100 It is giving an answer of -38.4762403 which is not even close (f(x) = 2.903809e+25 for x=-38.4762403). The answer should be around 0.01-0.1. This function should converge.. Even for a simple function like f(x) = exp(-x) * x, it gives

Dear Sirs/Madam, I am a beginner to R, and I am currently working on a data matrix which looks like this: > head(oligo) ko:K00001 ko:K00003 ko:K00005 ko:K00008 ko:K00009 ko:K00010 ko:K00012 AAA 370 631 365 67 164 455 491 KAA 603 1208 170 157 68

Dear Frauke, Thank you very much for taking the time to respond. You explanation was very helpful, and I now have that part figured out! Best Wishes, Dan Frauke Message: 3 Date: Mon, 12 Oct 2020 08:33:44 +0200 (CEST) From: =?UTF-8?Q?Frauke_G=C3=BCnther?= <guenther at leibniz-bips.de> To: "r-help at r-project.org" <r-help at r-project.org> Cc: William Michels <wjm1

Am 05.03.2018 um 13:04 schrieb Nicolas Kovacs <info at microlinux.fr>: > > Le 28/02/2018 ? 22:23, Nicolas Kovacs a ?crit : >> So far, I've only been able to filter HTTP. >> >> Do any of you do transparent HTTPS filtering ? Any suggestions, >> advice, caveats, do's and don'ts ? > > After a week of trial and error, transparent HTTPS filtering

Dear all, the exclude and constant.weights options are used as follows: exclude: A matrix with n rows and 3 columns will exclude n weights. The the first column refers to the layer, the second column to the input neuron and the third column to the output neuron of the weight. constant.weights: A vector specifying the values of the weights that are excluded from the training process and treated

The new messages are written in ------------------> ------------------- caas it wrote: | I am using samba-3.0.7 on kernel version 2.6.5-3 | (client as well as server). | I traced the exact function calling sequence when a | "mkdir" command is given at the client side. | I got stuck at the server side, | | source/smbd/vfs.c - vfs_MkDir() - | SMB_VFS_MKDIR(conn,nam...

Hey guys, I have what i think is a really simple problem :( I installed the seqinr library. I want to do an RSCU analysis. But i can't get it to work in even the simplest case. for example, if i have a string read in: > newdata5 $testseq [1] "agtgagatgatagatagatagatagatagatagatagaccccccagata" and then i perform an RSCU analysis on it... >

Hi everyone, If you have experience using Samba < 2.0.7 with AutoCAD 2000/2000i or R14 on a LAN, where the Windows 2000 Professional clients running AutoCAD 2000/2000i are opening .dwg files and XREFS off of the server, particularly if you know tips on tuning Samba's performance so that AutoCAD reports it can't find files on the server or load XREFs, please either post your comments to

On 03/05/18 08:34, Bill Gee wrote: > > On Monday, March 5, 2018 7:23:53 AM CST Leon Fauster wrote: >> Am 05.03.2018 um 13:04 schrieb Nicolas Kovacs <info at microlinux.fr>: >>> Le 28/02/2018 ? 22:23, Nicolas Kovacs a ?crit : >>>> So far, I've only been able to filter HTTP. >>>> >>>> Do any of you do transparent HTTPS filtering ?

> Am 05.03.2018 um 15:34 schrieb Bill Gee <bgee at campercaver.net>: > > > On Monday, March 5, 2018 7:23:53 AM CST Leon Fauster wrote: >> Am 05.03.2018 um 13:04 schrieb Nicolas Kovacs <info at microlinux.fr>: >>> Le 28/02/2018 ? 22:23, Nicolas Kovacs a ?crit : >>>> So far, I've only been able to filter HTTP. >>>>

Hi Dr. Snow, & R-helpers, Thank you for your reply! I hadn't heard of the {microbenchmark} package & was excited to try it! Thank you for the suggestion! I did check the reference source for which() beforehand, which included the statement to remove NAa, and I didn't have any missing values or NAs: sum(is.na(dat$gender2)) sum(is.na(dat$gender)) sum(is.na(dat$y)) [1] 0 [1] 0 [1]

Hi there, In my last request I have asked info about backuppc and other backup solutions. After some test I have choosen bacula. Many people said it's too complex and try to make it works is a challenge. I've tested backuppc and I don't like it for a stupid reason... I must install on centos external software, configure a web server with cgi with suid enabled (apache does not have