search for: acas

Displaying 20 results from an estimated 47 matches for "acas".

Did you mean: acaso
2006 Apr 01
1
Russian CHARS
Hello samba, How can mount (smbmount) MSWIN2003 resource from Linux client (RHEL4U2) to see russian. I am using following command: # smbmount //srv2/v$ /mnt/backup/srv2 -o 'credentials=userpass,iocharset=KOI8-R,codepage=koi8r' What I should use env. variables or additional parameters from this command (smbmount) ? I see only that (but need russian and eng): What Women
2003 May 24
2
For the Australian Asterisk users
I've noticed that a few people here are from Australia. I'm wondering where you all get your hardware from. I'll probably order some of the X100P cards from Digium soon (and possibly some FXO cards), but for other things such as ATAs, etc. However - these obviously aren't ACA compliant. Does anybody know of compatible hardware (for POTS lines) that is ACA compliant? The cheapest
2018 Jul 07
3
Completar un for, que falla al faltarle algún dato.
Buenas noches; Además del proyecto que comenté antes y con el que sigo discutiendo, también me estoy peleando con otro... con el que también tropiezo. Necesito reordenar los datos presentados en dos columnas a filas y columnas. Los datos ideales serían algo así: Ques <- c(rep("Q1",3),rep("Q2",3),rep("Q3",3)) Info <- rep(c("aca", "ahi",
2009 Feb 19
0
Mac OS X file copy error in samba share on a samba-share
I have an issue with mac os x 2.5.6 who is trying to put a file on a samba share. Samba (3.0.28) is running on a CentOS 5.2 (2.6.18-92.1.13.el5). I put a file "users.txt" as user "carlo.maesen" and have the following Mac-error: "You cannot copy some of these items to the destination because their names are too long or contain invalid characters for the destination. Do
2013 Oct 23
3
Problema con Bioconductor y R 3.0.2
No se bien si hacer la pregunta aca, pero en la lista de correo de bioconductor he tenido algunos problemas para hacer la consulta. Por un error actualice R de la version 15.0.3 a la 3.0.2, y ahora no me corren las librerias de bioconductor. Al intentar usar alguna me aparece el mensaje : Your Bioconductor is out-of-date, upgrade to version 2.13 by following instructions at
2010 Jan 29
1
Lyapunov Discrete Time Equation
Dear all, I need to solve the following Lyapunov Matrix equation: C=ACA' + B, with A and B given square symmetric matrices. Does anyone knows of a package that can solve the lyapunov matrix equation in R? Or even a C/Fortran implementation? I did not find one on netlib. Thank you.
2004 Nov 27
1
an excecute error
this it is the first time that I program with ogg libraries (I am a beginner). it has happened me an error, the code is the following one: /*********************************************/ OggVorbis_File *musica=NULL; FILE *archiv =NULL; archiv = fopen("prueba.ogg","r"); if(archiv==NULL) exit(0); int falla = ov_open(archiv,musica,NULL,0);//aca se produce el error
2010 Sep 28
3
calcular la variancia de gini por bootstrap
Hola, paso el mini programita q estoy viendo, lo q me llama la atencion es una parte donde se definen las funciones. Probe primero meter adentro del boots la estadistica a estimar usando directamente gini(varible, pesos) pero no me dejo. Vi q en el ej del manual de boots, siempre define antes la funcion, entonces probe definir antes una funcion haciendo grini<-function(x) {gini(variable,
2012 Feb 29
1
codon usage bias
Hey guys, I have what i think is a really simple problem :( I installed the seqinr library. I want to do an RSCU analysis. But i can't get it to work in even the simplest case. for example, if i have a string read in: > newdata5 $testseq [1] "agtgagatgatagatagatagatagatagatagatagaccccccagata" and then i perform an RSCU analysis on it... >
2018 Aug 30
2
R_tempDir
Gracias Eric, podría ser un problema de permiso por el antivirus nuevo desde el sistema, me pasó escribiendo un texto de Word, entre productos de Microsoft se bloquearon, aunque no vi mensaje alguno. Investigare su sugerencia. Javier El jue., 30 de ago. de 2018 12:11 PM, Eric <ericconchamunoz en gmail.com> escribió: > Hola Javier, Windows tiene el problema de que aunque reinstales
2003 Jan 30
2
mgcv, gam
Hola! I have some problems with gam in mgcv. Firts a detail: it would be nice igf gam would accept an na.action argument, but that not the main point. I want to have a smooth term for time over a year, the same pattern repeating in succesive years. It would be natural then to impose the condition s(0)=s(12). Is this possible within mgcv? I tried to obtain this with trigonometric terms, aca:
2018 Aug 30
2
R_tempDir
Estimados Tengo un error en windows 10, el mensaje dice : Error fatal: cannot create R_tempDir No tengo ni idea que pasó, esta semana no utilicé a R, hace dos semanas seguro que sí, en el medio aparece el error, desinstalé y reinstalé rstudio, de la misma forma R-Open de Microsoft 3.5.1, eliminé R client y visual studio fue actualizado ayer. Intenté iniciar RServer desde visual studio y no
2018 Aug 30
2
R_tempDir
Hola, Prueba a localizar el directorio donde está R instalado y da permisos completos a toda la carpeta y subcarpetas. También pasa esto en linux y se soluciona de la misma manera. Saludos, Carlos Ortega www.qualityexcellence.es El 30 de agosto de 2018, 22:59, Javier Marcuzzi < javier.ruben.marcuzzi en gmail.com> escribió: > Estimados > > Probé la idea sobre permisos, en windows
2014 Jul 04
2
error al leer una linea desde un archivo de texto
Que raro, habia enviado este email, pero creo que nunca salio de mi compu ... gracias a todos por sus sugerencias ... eric. Estimados todos, gracias por las sugerencias, al final lo resolvi de un modo "carretero" como decimos aca, por el camino largo. Como no eran demasiados los archivos corte el contenido y lo pegue en un nuevo archivo y funciono. Sin embargo, sigo sin saber la
2018 Aug 30
2
R_tempDir
Estimados Hay algo que no sale como se espera, di todos los permisos desde el sistema dentro de las opciones de seguridad, y desde las carpetas como si todos fuesen administradores, pero el error continúa, sin embargo como usuario administrador no tiene inconvenientes, lógicamente no voy a andar todo el día como administrador porque ante un error el desastre que haría. Pensaré, intentaré, de
2010 Sep 29
0
Resumen de R-help-es, Vol 19, Envío 28
Hola Ivan gracias por tu ayuda, justo ayer a ultima hora hice una modificacion en el programa q hizo q el programita ande, aunq no entendi porque lo hizo. La modificacion fue agregar "*w" al final de cada parametro en la definicion de la funcion "grini" q habia creado, cosa q deduje de mirar la funcion q le habia robado al ejemplo del manual de boot ratio <- function(d, w)
2020 Oct 28
0
nlme: New variance function structure varConstProp
Dear R developers, recently I have written a wishlist bug report for nlme containing a patch that adds the variance function structure s2(v) = t1^2 + t2^2*v^2 where v denotes the variance covariate, s2(v) denotes the variance function evaluated at v, and t, t1 and t2 are the variance function coefficients. The covariate can also be the fitted response. The idea that the residual variance
2023 Jul 21
0
International Protocol, Dilomatic Relations and Statecraft 2023 Face to Face Training Invitation
ACAE Global would like to extend this invitation to you and your organization to join us for International Protocol, Dilomatic Relations and Statecraft 2023 Face to Face Training (5 days), which will take place at the venues listed below to accommodate every participant across the globe. -------------- next part -------------- An HTML attachment was scrubbed... URL:
2013 Oct 23
0
Problema con Bioconductor y R 3.0.2
Hola Eric, Cual es tu sessionInfo()? Gracias, Jorge.- Sent from my phone. Please excuse my brevity and misspelling. > On Oct 23, 2013, at 6:59 AM, neo <ericconchamunoz en gmail.com> wrote: > > No se bien si hacer la pregunta aca, pero en la lista de correo de > bioconductor he tenido algunos problemas para hacer la consulta. > > Por un error actualice R de la version
2004 Jun 08
1
wondershaper under Debian
Hi everybody! I know this discussion list isn´t just about wondershaper, but i think someone can help me. I used to have a linux box running red hat 8, as firewall on my lan. I upgraded to debian 3.0 and tried to use the same wondershaper files under debian, but, when i run wondershaper on ppp0 device, it just stops transfering. Remember: its the same files i used with success under red hat 8.