search for: 19.5

CentOS Errata and Security Advisory 2011:0182 Important Upstream details at : https://rhn.redhat.com/errata/RHSA-2011-0182.html The following updated files have been uploaded and are currently syncing to the mirrors: ( md5sum Filename ) x86_64: 0fcc8980fc295385c0ee0c2a71c88910 openoffice.org-base-3.1.1-19.5.el5_5.6.x86_64.rpm f1ed5757f44520c5f75f7a733cc0d973

CentOS Errata and Security Advisory 2010:0459 Moderate Upstream details at : https://rhn.redhat.com/errata/RHSA-2010-0459.html The following updated files have been uploaded and are currently syncing to the mirrors: ( md5sum Filename ) i386: d57925d52e7175b822b02f0deb56ee21 openoffice.org-base-3.1.1-19.5.el5_5.1.i386.rpm 5f981b1deedc11f1a9fd1e2aa28c7a8e

CentOS Errata and Security Advisory 2011:0182 Important Upstream details at : https://rhn.redhat.com/errata/RHSA-2011-0182.html The following updated files have been uploaded and are currently syncing to the mirrors: ( md5sum Filename ) i386: 8ff1d432d02a981f5918ed7bec53b863 openoffice.org-base-3.1.1-19.5.el5_5.6.i386.rpm eea433d27f0a7d2514231ed98db46622

CentOS Errata and Security Advisory 2010:0459 Moderate Upstream details at : https://rhn.redhat.com/errata/RHSA-2010-0459.html The following updated files have been uploaded and are currently syncing to the mirrors: ( md5sum Filename ) x86_64: ae41ba0696a6a9986bae400a2aabee4c openoffice.org-base-3.1.1-19.5.el5_5.1.x86_64.rpm 9df64bbafa4ce5743a158b890fbd7032

Send CentOS-announce mailing list submissions to centos-announce at centos.org To subscribe or unsubscribe via the World Wide Web, visit http://lists.centos.org/mailman/listinfo/centos-announce or, via email, send a message with subject or body 'help' to centos-announce-request at centos.org You can reach the person managing the list at centos-announce-owner at centos.org When

Dear all, I would like to model the relationship between y and x. y is binary variable, and x is a count variable which may be possion-distribution. I think it is better to divide x into intervals and change it to a factor before calling glm(y~x,data=dat,family=binomail). I try to use rpart. As y is binary, I use "class" method and get the following result. >

I was under the impression that the tree method (e.g. as implemented in rpart) was insensitive to monotonic transformations of the dependent variable. e.g. Breiman Olshen et al. Classification and Regression Trees state "In a standard data structure [a tree] is invariant under all monotone transformations of individual ordered varaibles" (p. 57) However, I get very different results

Dear R users, Suppose I have the following data.frame: myID myType myNum1 myNum2 myNum3 a Single 10 11 12 b Single 15 25 35 c Double 22 33 44 d Double 4 6 8 and I want to have new records: myID myType myNum1 myNum2 myNum3 e Single 12.5 18

Hello All: I have a vector of data, z > z [1] 0.1 0.1 0.1 0.1 0.2 0.2 0.3 0.3 0.3 0.4 0.5 0.5 0.5 0.7 0.7 0.7 0.9 0.9 1.1 [20] 1.1 1.2 1.3 1.4 The first 4 elements have values of 0.1 followed 2 elements with values 0.2. When I invoke rank(z), I expected to get (1+2+3+4)/4 = 2.5 for the first 4 elements in the ranking and (5+6)/2 = 5.5 for elements 5 and 6. But what I do

Dear all, I have the following data frame: > dat V1 V2 V3 V4 V5 V6 V7 V8 V9 1 1 AAAACACCCACCCCCCCCCCCCCCCCCCCCCCCC 9.0 18 12.00 18.0 15.0 12.0 6.0 2 1 ACGATACGGCGACCACCGAGATCTACACTCTTCC 18.0 8 12.00 18.0 15.0 12.0 18.0 3 1 ACTACTGCTCCCCCCCCACTCCCCCCCCCCCCCC 15.0 8 12.00 12.0 18.0 12.0 12.0 4 1 ACTTATACGGCGACCACCGAGATCTACACTCTTT 15.0

Hi, I'm searching for a function to subistute Values in a Matrix to new Values. For example: old value new value 1.1 6 1.2 7 . . . . . . 1.9 14 2.0 15 and 2.1 15.5 2.2 16 . . . . 2.9 19.5 3.0 20 There is a difference

Hello there, when using the function numSummary in Rcmdr and selecting more than one variable (without grouping), the grand mean across all variables is returned for each variable instead of the mean of each single variable. However, this happens only for the mean, and not for sd, quantiles and na. This is the output: > numSummary(dataset1 [,c("var1", "var2")],

I apologize that I've asked a similar question before, but being new to R I don't think I did a very good job of formating the question. I've included a text file since the date set is somewhat large. What I have is a huge string of numbers in a text file. The numbers are all separated by comma's and the groups are separated by a semicolon. What I would like to do is read each

Further to the discussion between Murray Jorgensen and Brian Ripley, it seems to me better to choose tabulations that will not come and bite you. Suppose your data are sligtly irregular, e.g. (for the sake of the argument): data( warpbreaks ) warpbreaks$variant <- rep( 1:5, len=54 ) attach( warpbreaks ) tb <- table( wool, tension, variant ) tb # in this case you would like to see: tp

Further to the discussion between Murray Jorgensen and Brian Ripley, it seems to me better to choose tabulations that will not come and bite you. Suppose your data are sligtly irregular, e.g. (for the sake of the argument): data( warpbreaks ) warpbreaks$variant <- rep( 1:5, len=54 ) attach( warpbreaks ) tb <- table( wool, tension, variant ) tb # in this case you would like to see: tp

Hi, I would like to import some daily financial data from excel via csv. More specifically, I would like to be able to use the ts.union function from the tseries library as the dates are irregular and I need to line up the dates so that I can place all the variables into one data frame. The trouble is, how do I import the dates from excel into R? At the moment I'm just importing the data

Hi all. I am having a problem using color2D.matplot I am trying to visualize several different matrices under two color ranges. One color range corresponds to values less than 1 and the second color range for values greater than 1. However, the minimum value of each matrix differs and is automatically set to have the smallest value in the color range. Similarly, the maximum value of each matrix

In order to get an OpenOffice configuration that is closer in compatibility with MS Office 2007, I removed the standard OO in 5.4 via yum and installed the latest (3.2.0) from OpenOffice.org. Ran that config for many months without a problem. However, when I allowed the upgrade to 5.5, OO broke. I finally had to remove all traces of OO 3.2.0, and start over. That worked...until yum tells me that

Hello I am trying to install the R RPM for Suse 10.0 on an x86_64 PC. However I am failing a dependency for "libpng12.so.0" straight away PC5-140:/home/rmgzshd # rpm -i R-base-2.5.0-2.1.x86_64.rpm error: Failed dependencies: libpng12.so.0(PNG12_0)(64bit) is needed by R-base-2.5.0-2.1.x86_64 I do seem to have this file PC5-140:/home/rmgzshd # whereis libpng12.so.0

Hello I apologize in advance if this question has already be posted on the list, although I could not find a relevant thread in the archives. I would like to overlay xyplots using different datasets for each plot. I typically work on the following data.frame (mydata) structure >mydata Drug Time Observed Predicted 1 A 0.05 10