similar to: write.fasta (seqinr package)

Dear R users, seqinR 1.0-5 has been released yesterday on CRAN, so that the source code of the package should be available on all CRAN mirrors within the next 24h. The updated package vignette is here: http://pbil.univ-lyon1.fr/software/SeqinR/seqinr_1_0-5.pdf User level visible changes are: o A new function dotPlot() is now available.

Dear R users, seqinR 1.0-5 has been released yesterday on CRAN, so that the source code of the package should be available on all CRAN mirrors within the next 24h. The updated package vignette is here: http://pbil.univ-lyon1.fr/software/SeqinR/seqinr_1_0-5.pdf User level visible changes are: o A new function dotPlot() is now available.

I suspect you meant WD <- "~/Documents/Scripting/R_Studio/Sequences/" but I am entirely unfamiliar with the packages you are using, and know nothing about what is on your hard drive. For future reference: A) Read the Posting Guide. This is a plain text email list, and your html formatting gets removed leaving a mess that is not always readable. B) Most frequent users of R

Hi all, I am learning R by "doing". And this is my first post. I want to use R: 1- to fetch a DNA sequence from a databank (see bellow) and 2- store it as FASTA file. The problem: neither an error is prompted nor the fasta file is created. Testing the code (see bellow), I notice that everything works until the *"write.dna" *command - which is not creating the fasta file.

Dear useRs, the seqinR package contains utilities to import and analyze biological sequence data. For a general introduction see this document: http://pbil.univ-lyon1.fr/software/SeqinR//vignette.pdf Please do not use r-help for questions about seqinR or r-bugs for bug report about seqinR. Use instead the seqinR diffusion list: http://pbil.univ-lyon1.fr/software/SeqinR//mailing.php?lang=eng A

Dear useRs, the seqinR package contains utilities to import and analyze biological sequence data. For a general introduction see this document: http://pbil.univ-lyon1.fr/software/SeqinR//vignette.pdf Please do not use r-help for questions about seqinR or r-bugs for bug report about seqinR. Use instead the seqinR diffusion list: http://pbil.univ-lyon1.fr/software/SeqinR//mailing.php?lang=eng A

Hi everybody, I have a large fasta file(15M) which contains a lot of DNA sequence in fasta format.And i want to get probabilities matrix for 2nd order markov china from this background.Here is a web tool, http://tandem.bu.edu/markov.html.But i can not upload a large file. I wonder if there is a R packages can do this ,Thanks in advance . Jiantao Shi **

Hi all, I have a sequence file (fasta format) and want to calculate the rho statistics for dinucleotide abundance value on my data.. the code which I use is (using seqinr library and current working directory) seq_info<-read.fasta("gene.txt") rho(seq_info[1],2) but it yields only the dinucleotides, not their rho values, i.e, > rho(seq_info[1],2) aa ac ag at ca cc cg ct ga gc

Dear useRs, The seqinR package is a library of utilities to retrieve and analyse biological sequences. A new version of seqinR, seqinR 1.0-7, has been released on CRAN. Here is a summary of changes: o A new *experimental* function extractseqs() to download sequences thru zlib compressed sockets from an ACNUC server is released. Preliminary tests suggest that working with about 100,000

Dear useRs, The seqinR package is a library of utilities to retrieve and analyse biological sequences. A new version of seqinR, seqinR 1.0-7, has been released on CRAN. Here is a summary of changes: o A new *experimental* function extractseqs() to download sequences thru zlib compressed sockets from an ACNUC server is released. Preliminary tests suggest that working with about 100,000

Hi! I am trying to analyse my data using amova (http://www.oga-lab.net/RGM2/func.php?rd_id=pegas:amova): My input to R is a DNA sequence file, format=fasta dna<- read.dna("XX.fasta", format="fasta") #left other options as default d<- dist.dna(dna, model="raw") g<- read.table("XXX.design") Load necessary libraries: library(pegas)

I am trying to pull a subset form a large group of FASTA sequences. I need to pull them based on the annot and write.fasta them. I have my subset annot titles in a .csv. What is the way to go about this? I tried pulling the sequences from a .csv but then MEGA 5 was not happy when i tried to put them back and I need to use MEGA to keep my data uniform. Any help would be greatly appreciated Thank

Dear R developers I am currently working on the seqinR package. The seqinR package allows a remote access to biological databases via a socket connection. We are using the functions socketConnection, writeLines and readLines to open the socket, send request to the server and receive response from the server respectively. Recently, a new function implemented in the socket server allows

Dear all, I have DNA sequence data which are fasta-formatted as >gene A;..... AAAAACCCC TTTTTGGGG CCCTTTTTT >gene B;.... CCCCCAAAA GGGGGTTTT I want to load only the lines that start with ">" where the annotation information for the gene is contained. In principle, I can remove the sequences before loading or after loading all the lines. I just wonder if there's a way to

Hi - When I'm trying to read in a text file into a labeled character array, the memory stamp/footprint of R will exceed 4 gigs or more. I've seen this behavior on Mac OS X, Linux for AMD_64 and X86_64., and the R versions are 2.4, 2.4 and 2.2, respectively. So, it would seem that this is platform and R version independant. The file that I'm reading contains the upstream regions

Hi, I want to analyse DNA sequence data (mtDNA) in R as in calculate Fst, Heterozygosity and such summary statistics. Package Adagenet converts the DNA sequence into retaining only retaining the polymorphic sites and then calcuates Fst.. but is there any other way to do this? I mean analyse the DNA sequence as it is.. and calculate the statistics? Thanks! [[alternative HTML version deleted]]

Good afternoon. I am a master student in University of Porto in Portugal. At this moment I’m starting to use R, so I have some doubts. The aim of my analysis is: calculate a pairwise FST matrix from fasta file and creat a principal component analyses with adegenet package (I use seqinr and ape package to read this file, then I convert this file into a genind object with DNA2genind function

 Sir,  I am a student in biostat and bioinformatics.  I am interested to use R for my research work related to codon usage analysis.This software was used in a publication entitled " Online synonymous codon usage analyses with the ade4 and seqinR packages" and a weblink  http://pbil.univ-lyon1.fr/datasets/charif04/ was given for readers to use the program. Now  I would like to use the

Hello I have 2 columns of short sequences that I would like to compare and count the number of mismatches and record the number of mismatches in a new column. The sequences are part of a data frame that looks like this: seq1=c("CGGTGTAGAGGAAAAAAAGGAAACAGGAGTTC","CGGTGGTCAGTCTGGGACCTGGGCAGCAGGCT", "CGGGCCTCTCGGCCTGCAGCCCCCAACAGCCA")

Hi, I am very new to R and wanted to know if there is a package that, given very long nucleotide sequences, searches and identifies short (7-10nt) motifs.. I would like to look for enrichment of certain motifs in genomic sequences. I tried using MEME (not an R package, I know), but the online version only allows sequences up to MAX 60000 nucleotides, and that's too short for my needs..