similar to: Substitute Values in a Matrix?

Hello, It's an alternative to use SAS by function in R? I want to plot d histograms by plot.from example bellow: Thank you! plot d 1 1 16.3 2 1 25.0 3 1 57.8 4 1 17.0 5 2 10.8 13 2 96.4 17 3 76.0 18 3 32.0 19 3 11.0 20 3 11.0 24 3 106.0 25 3 12.5 21 4 19.3 22 4 12.0 26 4 15.0 27 5 99.3 32 7 11.0 36

Hi, I am very new to R and I've been trying to work through the R book to gain a better idea of the code (which is also completely new to me). Initially I imputed my data from a text file and that seemed to work ok, but I'm trying to examine linear relationships between gdist and gair, gdist and gsub, m6dist and m6air, etc. This didn't work and I think it might have something to do

Hi all! I tried to perform Shapiro-Wilk test for my sample of 243 values. > Us [1] -10.4 -13.1 -12.2 38.1 -18.8 -13.3 -11.7 29.3 49.7 6.8 12.7 16.3 [13] 5.8 -0.7 -29.4 4.1 38.8 -1.4 8.8 15.6 32.9 -5.3 19.1 35.8 [25] 4.0 -1.5 0.6 -4.2 -10.0 -4.0 1.1 48.9 -21.0 -5.3 5.8 -10.8 [37] 21.9 8.2 -3.2 -3.9 -2.3 12.6 -4.7 -8.0 11.8 27.4 -9.5 -20.8 [49]

Hi, I haven't tried the code yet. Is there a way to parse this data using R and create bar plots so that each program's 'RAM used' figures are grouped together. So 'uuidd' bars will be together. The data will have about 50 sets. So if there are 100 processes each will have about 50 bars. What is the recommended way to graph these big barplots ? I am looking

I can't seem to use the point-and-click identify() function properly. I'm running R 2.5.1 (I know, I need to get around to upgrading) under Win XP. The problem is, when I click on a point on the graph, I get an error, "no point within 0.25 inches." But in some areas, I can click where there is no visible point anywhere close, and an identify() label will pop up. The troublesome

Hello R guru's I am a newbie to R, In my research work I usually generate a lot of ELISA data in form of absorbance values. I ususally use Excel to calculate the concentrations of unknown, but it is too tedious and manual especially when I have 100's of files to process. I would appreciate some help in creating a R script to do this with minimal manual input. s A1-G1 and A2-G2 are

Further to the discussion between Murray Jorgensen and Brian Ripley, it seems to me better to choose tabulations that will not come and bite you. Suppose your data are sligtly irregular, e.g. (for the sake of the argument): data( warpbreaks ) warpbreaks$variant <- rep( 1:5, len=54 ) attach( warpbreaks ) tb <- table( wool, tension, variant ) tb # in this case you would like to see: tp

Further to the discussion between Murray Jorgensen and Brian Ripley, it seems to me better to choose tabulations that will not come and bite you. Suppose your data are sligtly irregular, e.g. (for the sake of the argument): data( warpbreaks ) warpbreaks$variant <- rep( 1:5, len=54 ) attach( warpbreaks ) tb <- table( wool, tension, variant ) tb # in this case you would like to see: tp

Dear R-User, Appreciate any helps. It looks simple, but I don't have a clue. Given that I have a dataframe of tree population with three variables: sp=species , d0=initial_size grow=growth increment from initial size per year How can I calculate the future growth increment of each tree for the next 3 years. The following Rscript was written, #---------- a0 <-

hello, I'd like know how to sort a data frame in R for example how I should do to sort by Catholic with swiss data frame like below thanks Fertility Agriculture Examination Education Catholic Infant.Mortality Courtelary 80.2 17.0 15 12 9.96 22.2 Delemont 83.1 45.1 6 9 84.84 22.2

I have two large datasets (156K and 2.06M records). Each row has the hour that an event happened, represented by an integer from 0 to 23. R's histogram is combining some data. Here's the command I ran to get the histogram: > histinfo <- hist(crashes$hour, right=FALSE) Here's histinfo: > histinfo $breaks ?[1] ?0 ?1 ?2 ?3 ?4 ?5 ?6 ?7 ?8 ?9 10 11 12 13 14 15 16 17 18 19 20 21

When printing a table it is broken at some point (depending how long are the associated names) >>> see example below. Is there a way to control number of columns being printed for a given chunk of the table? Best regards, Ryszard > z5 AAAAAAA BBBBBBB CCCCCCC DDDDDDD EEEEEEE FFFFFFF GGGGGGG HHHHHHH IIIIIII AAAAAAA 1.00 -0.69 -0.54 -0.88 NA NA NA

I am attempting to graph 12 months of temperatures, delineate the months with a vline and place the names of the months at the top of the graph. So far I have gotten everything to work except the names, despite getting a similar graph to work yesterday the day before yesterday with Baptise A's help. Can anyone suggest what I am doing wrong. Data set is below code. Thanks. Code

I had a problem annotating a graph last year ( see http://n4.nabble.com/Putting-names-on-a-ggplot-td907158.html#a907158 for the discussion) Stefan (smu) provided a solution using annotate(). However I apparently did not update the graph file and,now, when I go back to the thread and try to use Stefan's solution it does not seem to work although I am sure that it did then. The problem

I have a simple vector, called tmp that I want to subset based on another vector called vec. Everything works as expected except for below where the subsetting returns something other than the original data. Any ideas? > vec <- c(1,2,3,4,5,59,60,27,32,21) > tmp [1] 1.0 1.1 2.0 2.1 2.2 3.0 3.1 4.0 5.0 5.1 6.0 7.0 8.0 8.1 9.0 [16] 9.1 9.2 10.0 10.1 11.0 12.0 13.0 14.0

Hello, I have to add "Age (bar(x)=14.3) as a title on a chart. I am unable to get this to working. I have tried bquote, substitute and expression, but they are only doing a part of the job. new<- c(14.3, 18.5, 18.1, 17.7, 18, 15.9, 19.6, 17.3, 17.8, 17.5, 15.4, 16.3, 15, 17.1, 17.1, 16.4, 15.2, 16.7, 16.7, 16.9, 14.5, 16.6, 15.8, 15.2, 16.2, 15.6, 15, 17.1, 16.7, 15.6, 15, 15.8, 16.8,

Hola!! tengo un data.frame donde cada fila corresponde a un año y cada columna a un mes (De enero a diciembre) > head(valT) V2 V3 V4 V5 V6 V7 V8 V9 V10 V11 V12 V13 1941 18.0 16.3 15.2 10.1 8.1 8.3 8.8 9.2 7.9 12.2 11.9 14.6 1942 17.2 15.9 13.6 11.6 8.7 6.2 6.4 7.2 9.7 12.0 14.1 16.7 1943 17.6 17.3 13.5 12.5 10.5 7.0 8.2 7.9 -999.9 -999.9

Dear all, I have the following data frame: > dat V1 V2 V3 V4 V5 V6 V7 V8 V9 1 1 AAAACACCCACCCCCCCCCCCCCCCCCCCCCCCC 9.0 18 12.00 18.0 15.0 12.0 6.0 2 1 ACGATACGGCGACCACCGAGATCTACACTCTTCC 18.0 8 12.00 18.0 15.0 12.0 18.0 3 1 ACTACTGCTCCCCCCCCACTCCCCCCCCCCCCCC 15.0 8 12.00 12.0 18.0 12.0 12.0 4 1 ACTTATACGGCGACCACCGAGATCTACACTCTTT 15.0

En indlejret tekst med ukendt tegns?t er blevet fjernet... Navn: ikke tilg&aelig;ngelig Url: <https://stat.ethz.ch/pipermail/r-help/attachments/20081105/3106f04e/attachment.pl>

Hi guys, I''m running a freenas domU (FreeBSD 8.3 based, ZFS v28, 2 vcpus mapped to the same HT capable core) to serve storage for all purpose including other domUs running on the same host. I did some study to understand how well it works and the result is kind of confusing. In summary, the network performance between domains on the same host is worse than expected. And NFS service to