similar to: Hello,

Hi all, I'm using Ubuntu 14.04 samba 4.1.6 packages, attempting to set up a server for file shares AD clients can use. My previous setup was a simple AD join with a user map file (1 to 1 AD to unix user) that i've been migrating for approximately 7 years, and with the last 2003 AD server removed from the network it stopped working (2008 R2 DC's now). After approximately 2 weeks of

2015-05-04 13:01 GMT+02:00 Rowland Penny <rowlandpenny at googlemail.com>: > On 04/05/15 04:02, Carl Gherardi wrote: > >> Hi all, >> >> I'm using Ubuntu 14.04 samba 4.1.6 packages, attempting to set up a server >> for file shares AD clients can use. My previous setup was a simple AD join >> with a user map file (1 to 1 AD to unix user) that i've

Hi, I am trying to install the package exonmap and RMySQL however I keep getting the following error: "Error in library(pkg, character.only = TRUE) : 'RMySQL' is not a valid package -- installed < 2.0.0?" I have R version 2.4.1 so I know its not a version issue. I deleted and reinstalled the folders again and the same thing happened. Has anyone any ideas? Thanks,

Hello, I have been having problems installing the Login Engine. I follow all the steps found on the download site (rails-engines.org), but when I get to the DB_SCHEMA step, I do rake engine_migrate ENGINE=login in the application root. """ C:\rails\cag> rake engine_migrate ENGINE=login (in C:/rails/cag) rake aborted! Don''t know how to build task

Dear all, I wrote the following batch script on a iMac, and ran it on a linux mosix cluster. tu <- read.table("cage.mm5.tags.rna_lib.CAA-CAJ.tu-reshape.table") tu_reshaped <- t(reshape(tu[1:50,], direction="wide", timevar="tu", idvar=c("rna","lib"))) write.table(tu_reshaped, "cage.mm5.tags.rna_lib.CAA-CAJ.tu-reshaped.table")

Hi. Background - I am working with a dataset involving around 750K observations, where many of the variables (8/11) are unordered factors. The typical model used to model this relationship in the literature has been a simple linear additive model, but this is rejected out of hand by the data. I was asked to model this via kernel methods, but first wanted to play with the parametric

An embedded and charset-unspecified text was scrubbed... Name: ?????? ?? ????????. URL: <https://stat.ethz.ch/pipermail/r-help/attachments/20080818/dcaa0623/attachment.pl>

On 04/05/15 04:02, Carl Gherardi wrote: > Hi all, > > I'm using Ubuntu 14.04 samba 4.1.6 packages, attempting to set up a server > for file shares AD clients can use. My previous setup was a simple AD join > with a user map file (1 to 1 AD to unix user) that i've been migrating for > approximately 7 years, and with the last 2003 AD server removed from the > network it

Wine release 20010510 on Linux 2.4.4 SMP compiled from source code. One in ten times, when I start wine (with an executable or without) the program will segfault. Notes: 1. This doesn't happen when I run wine under the debugger. 2. I turned on --debugmsg +all to see if I could pinpoint the reason. When it deosn't segfault, I get loads of debug messages. When it DOES fault, I get

Hey guys, I have what i think is a really simple problem :( I installed the seqinr library. I want to do an RSCU analysis. But i can't get it to work in even the simplest case. for example, if i have a string read in: > newdata5 $testseq [1] "agtgagatgatagatagatagatagatagatagatagaccccccagata" and then i perform an RSCU analysis on it... >

Hi, With help from Oleg we got the right patches applied and NFS working well. Maximum performance was about 60 MB/sec. Last week that dropped to about 12.5 MB/sec and I cannot find a reason. Lustre clients all obtain 100+ MB/sec on GigE. Each OST is good for 270 MB/sec. When mounting the client on one of the OSSs I get 230 MB/sec. Seems the speed is there. How can NFS and Lustre be tuned

Nick Lewycky wrote: > Andreas Bolka wrote: >> Hi all, >> >> I'd like to have a first stab at a loop-based auto-vectorization pass as >> part of 2009's Google Summer of Code program. As far as I can tell from >> searching the mailing list archives, no work on such an auto-vectorizer >> seems to be currently in progress. > > Hi Andreas, >

http://bugzilla.mindrot.org/show_bug.cgi?id=138 patl at cag.lcs.mit.edu changed: What |Removed |Added ---------------------------------------------------------------------------- Status|RESOLVED |REOPENED Resolution|FIXED | ------- Additional Comments From patl at cag.lcs.mit.edu 2002-05-13 00:55

http://defect.opensolaris.org/bz/show_bug.cgi?id=971 Summary: zfs key -l fails after unloading (keyscope=dataset) Classification: Development Product: zfs-crypto Version: unspecified Platform: Other OS/Version: Solaris Status: NEW Severity: major Priority: P2 Component: other AssignedTo:

http://bugzilla.mindrot.org/show_bug.cgi?id=138 mouring at eviladmin.org changed: What |Removed |Added ---------------------------------------------------------------------------- CC| |vjo at dulug.duke.edu ------- Additional Comments From mouring at eviladmin.org 2002-03-08 04:49 ------- *** Bug 139 has been

http://bugzilla.mindrot.org/show_bug.cgi?id=177 Summary: chroot tools for OpenSSH 3.1p1 Product: Portable OpenSSH Version: -current Platform: Other URL: http://cag.lcs.mit.edu/~raoul/. OS/Version: other Status: NEW Severity: enhancement Priority: P3 Component: sshd AssignedTo:

Dear James and Chris, I would like to buid openssh with the chroot patch. I applied the http://cag.lcs.mit.edu/~raoul chroot patch to openssh-3.1p1, configured it using a simple "--with-chroot" for testing and compiled under Mandrake 8.2. Problem : 1) Configuration report shows no chroot configuration. What is wrong? 2) After compiling, I added a test user with

http://defect.opensolaris.org/bz/show_bug.cgi?id=2057 Summary: zpool key -u - permission denied should be clear Classification: Development Product: zfs-crypto Version: unspecified Platform: Other OS/Version: Solaris Status: NEW Severity: minor Priority: P3 Component: other AssignedTo: ajscarp

http://bugzilla.mindrot.org/show_bug.cgi?id=177 djm at mindrot.org changed: What |Removed |Added ---------------------------------------------------------------------------- Attachment #683 is|0 |1 obsolete| | Attachment #1018 is|0 |1 obsolete|

luxury watches, + cheap and delivery. - &#104;ttp&#58;/&#47;&#103;oo.&#103;l&#47;7&#99;5A&#83;a &#104;ttp&#58;&#47;/go&#111;.gl&#47;&#68;8zJ&#103;4 h&#116;tp:&#47;/&#103;&#111;o&#46;g&#108;/Fm&#119;&#122;&#111;2 ozzko ky jpmuf uievj cx c edhs vdcb o itj ky jxin nisbd awtbi nid nuyzv el a beuj