similar to: merge some columns

I'm trying to make correlograms using corrgram. See below for a simple example. #### library(corrgram) data(baseball) vars1 <- c("Assists","Atbat","Errors","Hits","Homer","logSal") vars2 <- c("Putouts","RBI","Runs","Walks","Years")

Dear all, I would like to know how can I retrieve a data.frame without the columns that have a partial match name. Let´s say that I have a data.frame with 200 columns and 100 of them have the name "StartX", with X being the unique part for each column name. I want to delete all columns that have the name starting with "Start". I´ve tried to do this but it doesn´t work: >

Hi, I would like to know how can I keep adding data to a file while doing a loop and without deleting the data of the previous iteration. Thanks.

Dear all, I would like to know how can I create a binned column in a data.frame. The output that I would like is something like this: Start Binned_Start 1 0-5 2 0-5 6 5-10 8 5-10 13 10-15 ... Best regards João Fadista Ph.d. student UNIVERSITY OF AARHUS Faculty of Agricultural Sciences Dept. of Genetics and Biotechnology Blichers

Dear all, Can I do a permutation test if the number of individuals in one group is much bigger than in the other group? I searched the literature but I didin´t find any assumption that refers to this subject for permutation tests. Best regards João Fadista Ph.d. student UNIVERSITY OF AARHUS Faculty of Agricultural Sciences Dept. of Genetics and Biotechnology Blichers Allé 20, P.O.

Dear all, I would like to take out the values from one vector that are equal to the values in another vector. Example: a <- c(1,2,3,4,5,6,7,8,9) b <- c(3,10,20,5,6) b_noRepeats = c(10,20) So I would like to have the vector b without the same values as vector a. Kind regards, João Fadista [[alternative HTML version deleted]]

Dear all, I would like to know how can I concatenate 2 data.frames into a single one. Both data frames have the same number of columns and the same class type in each correspondent column. So what I want is to have a new data.frame where I have first the values from one data.frame and then the values from a second data.frame would came after in this new data.frame. Thanks in advance. Med

Dear all, I would like to know how can I compute the length of a string in a dataframe. Example: SEQUENCE ID TGCTCCCATCTCCACGG HR04FS000000645 ACTGAACTCCCATCTCCAAT HR00000595847847 I would like to know how to compute the length of each SEQUENCE. Best regards, João Fadista [[alternative HTML version deleted]]

Dear all, I would like to know how to subset a data.frame by rows. Example: Probesets 34884 34888 34892 1 100009676_at A A A 2 10001_at P P P 3 10002_at A A A 4 10003_at A A

I have a data frame whose first colum contains the names of the variables and whose second colum contains the values to assign to them: : kkk <- data.frame(vars=c("var1", "var2", "var3"), vals=c(10, 20, 30), stringsAsFactors=F) If I do : assign(kkk$vars[1], kkk$vals[1]) it works : var1 [1] 10 However, if I try with mapply

Dear users, I have a double for loop that does exactly what I want, but is quite slow. It is not so much with this simplified example, but IRL it is slow. Can anyone help me improve it? The data and code for foo_reg() are available at the end of the email; I preferred going directly into the problematic part. Here is the code (I tried to simplify it but I cannot do it too much or else it

Hello everybody. I've been experimenting with mapply(). Does anyone else have problems with: R> mapply(rep,times=1:4, MoreArgs=42) (I get a seg fault). robin R> R.version _ platform powerpc-apple-darwin6.6 arch powerpc os darwin6.6 system powerpc, darwin6.6 status beta major 1 minor 8.0 year 2003 month 10 day 02 language R >

Dear all, I am using the R package SNPRelate but I found an error when I run the following command. Do you know what might be the problem? Thanks in advance. > vcf.fn <- system.file("extdata", "sequence.vcf", package="SNPRelate") > snpgdsVCF2GDS(vcf.fn, "test.gds") Start snpgdsVCF2GDS ... Open

Despite the spirited arguments of various R-core folks who feel that mle() doesn't need a "data" argument, and that users would be better off learning to deal with function closures, I am *still* trying to make such things work in a reasonably smooth fashion ... Is there a standard idiom for "merging" environments? i.e., suppose a function has an environment that I want

--KsGdsel6WgEHnImy Content-Type: text/plain; charset=iso-8859-1; format=flowed Content-Disposition: inline Content-Transfer-Encoding: 8bit Hi, people. Wandering in R archives, and seeing the message attached below, I noticed that: mapply(rep,times=1:4, MoreArgs=42) still segfaults on R 2.2.0, and thought I should be a good citizen and report it, even if I do not have an actual problem

Hello! I have noticed that mapply() drops names in R 2.3.1 as well as in r-devel. Here is a simple example: l <- list(a=1, b=2) k <- list(1) mapply(FUN="+", l, k) [1] 2 3 mapply(FUN="+", l, k, SIMPLIFY=FALSE) [[1]] [1] 2 [[2]] [1] 3 Help page does not indicate that this should happen. Argument USE.NAMES does not have any effect here as it used only in a bit special

Dear all, I would like to be able to subset a data.frame in a special way. I will put here an example: Score Name 88 000019_0070 88 000019_0070 87 000019_0070 79 002127_0658 79 002127_0658 77 002127_0658 So, for the above example I would like to have a new data.frame that has only the best "Score" for each

Dear all, I would like to be able to know the intervals of my data that overlap between them. Here it goes a small example: Input: Start End 440 443 380 443 290 468 Desired output: Start End 290 380 380 440 440 468 Best regards, João Fadista [[alternative HTML version deleted]]

Dear all, I would like to know how can I read a text file and create a data frame of only certain parts of the file. For instance, from this text file: =================================================== Matches For Query 0 (108 bases): 000019_0070 =================================================== Score Q_Name S_Name Q_Start Q_End S_Start S_End Direction Bases identity 89 000019_0070

Dear all, I would like to know how can I order a data.frame with increasing the dat$Interval (dat$Interval is a factor). There is an example below. Original data.frame: > dat Interval Number_reads 0-100 685 200-300 744 100-200 1082