similar to: problem in reading a sequence file

Dear all, I have a input file like following : AAAAT TTTAG TTAAC GGATT ACGTA How can I make a single vector with this like following: AAAATTTTAGTTAACGGATTACGTA Best regards Albert [[alternative HTML version deleted]]

Dear list, I am trying to write a package for simulating meioses in R. We defined a class 'haplotype' which contains the basic units of our simulation: setClass("haplotype",representation(snp = "numeric",qtl = "list", hID = "numeric",phID0 = "numeric",phID1 = "numeric"),

Hello, How can I read a xlsx file using xlsx package? Thanks Albert [[alternative HTML version deleted]]

Dear list, making mathematical expressions in plots is not difficult: expression(phi[1]) for example. At this moment I am stuck in creating a vector of expressions: pos <- 1:10 lab <- letters[pos] Now, I would like to create a vector of expressions which I could use for labeling the x-axis of a lattice plot. ll <- as.expression(paste(pos," phi[",lab,"]",sep =

Hello, I have recently had issues with read.csv where i get the following warning, and this happens on both my OSX and Linux machines. Here is the warning and an example CSV file is attached: Warning message: In read.table(file = file, header = header, sep = sep, quote = quote, : incomplete final line found by readTableHeader on 'test.csv' http://

Hi I am trying this > x <- read.table("/home/kenji/1245/GDS1_2grps_.cls", header = F, skip = 2) > x <- read.table("/home/kenji/1246/MYCset.cls", header = F, skip = 2) Warning message: In read.table("/home/kenji/1246/MYCset.cls", header = F, skip = 2) : incomplete final line found by readTableHeader on '/home/kenji/1246/MYCset.cls' Here are the

Hello, I am trying to read in an Excel file that I saved as a .csv so I can analyze my assignment data! I am getting really frustrated because this is what I keep getting: Warning message: In read.table("CityData.CSV", sep = "/", header = T) : incomplete final line found by readTableHeader on 'CityData.CSV' I have open the file and make sure click return after

I'm using read.csv to read in a csv file containing '#' characters. For example, say I'm reading the following file (test.csv): var1,var2,var3 a,b,c d,e#,f g,h,i It outputs: > read.csv("Raw Data\\test.csv") var1 var2 var3 1 a b c 2 d e 3 g h i Warning message: incomplete final line found by readTableHeader on 'Raw Data\test.csv'

Hello, I am trying to read in an Excel file that I saved as a .csv so I can analyze my dissertation data! I am getting really frustrated because this is what I keep getting: In read.table(file = file, header = header, sep = sep, quote = quote, : incomplete final line found by readTableHeader on 'month.csv' can anyone offer some help? Thanks a lot! catherine [[alternative HTML

Thank you Gabor Grothendieck for your answer !! i have charge the pachage but now i have this massage  read.table("c:/TOTAL.xls",h=T) [1] ÐÏ.à.. <0 rows> (or 0-length row.names) Warning messages: 1: In read.table("c:/TOTAL.xls", h = T) :   incomplete final line found by readTableHeader on 'c:/TOTAL.xls' 2: In if (!header) rlabp <- FALSE :   the condition has

df <- data.frame(a = "a\"b") write.table(df, "test.csv", sep = ",", row = F) Is there any to load test.csv into R correctly? I've tried the following: > read.table("test.csv", sep = ",") [1] V1 <0 rows> (or 0-length row.names) Warning message: In read.table("test.csv", sep = ",") : incomplete final line

Hi! Is it possible to easily cut & paste data from an Excel spreadsheet to an R edit( ) grid or to variable? It seems that R cannot handle the cell delimiters Excel hands over. Regards, Werner

Hello! I am trying to import data to R. The programm always responds with: "incomplete final line found by readTableHeader on Data.doc" What does that mean, and what could I change? Thank you very much in advance. Regards Florian Stallforth

Dear list, I am trying to develop a package. I used the function package.skeleton to make the directory tree of the package and then build and compiled the package as described (I hope). Now, I would like to increase the number of functions in the package without overwriting the existing package directory tree, so I put these new functions in the directory R of the tree. When I then build and

Hi all, I am running 64-bit R 2.15.0 on windows 7. I am trying to use read.delim to read from a file that has 2-byte unicode (CJK) characters. Here is an example of the data (it is tab-delimited if that gets messed up): HITId HITTypeId Title 2Q69Z6KW4ZMAGKKFRT6Q4ONO6MJF68 2LVJ1LY58B72OP36GNBHH16YF7RS7Z 看看句子，写写想法 请看以下的句子，再回答问 So read.delim (code below) doesn't read in correctly. It reads

hello! je veux importer un fichier de donnees excel que j'ai au prealable converti en fichier txt avec separateurs tab, fichier de la forme entree simple (suite de colonnes contenant des variables). Voila ma ligne de commande : > poussins <- read.table("poussins.txt", header=T, sep="\t") et sa reponse Erreur dans scan(file = file, what = what, sep = sep, quote =

Dear all, I am new R user and I am sure that this question has been asked quite often and I have also googled it and read about it! I understood that in order to read excel sheet into R you need to open it and saved it as csv or text, is this true? or you can use read.delim2 and read.csv2 to do this without the following error > dat <- read.csv2(file="C:\\Dokumente und

Hi all, I am trying to read a text file in R! I have a warning message: In read.table(file = "data1.txt", header = T) : uncompleted last line of readTableHeader in 'data1.txt' Could you please tell me why? and how can I deal with missing value when I read this file? all the best Alfons

I am so frustrated about reading data from this sample csv file. My code is : >test=read.csv(file='test.csv',header=T) warning message: In read.table(file = file, header = header, sep = sep, quote = quote, : incomplete final line found by readTableHeader on 'test.csv' >test [1] ??.?.. <0 rows> (or 0-length row.names) What is the problem here? Thanks

Hi all, I am trying to read Excel file usingthe follwoing commnad library(RODBC) data=odbcConnectExcel(file.choose()) sqlTables(data) Bdat=sqlFetch(data, "test") odbcClose(data) head(Bdat) 1. The above script works if the Excel file is opened. If the excel file is not opened then I get the following message "External table is not in the expected