similar to: regression function for categorical predictor data

Displaying 20 results from an estimated 200 matches similar to: "regression function for categorical predictor data"

2011 Jun 15
4
R string functions
Hi, I have a string "GGGGGGCCCAATCGCAATTCCAATT" What I want to do is to count the percentage of each letter in the string, what string functions can I use to count the number of each letter appearing in the string? For example, the letter "A" appeared 6 times, letter "T" appeared 5 times, how can I use a string function to get the these number? thanks, karena
2010 Aug 05
2
questions about string handling
Hi, I have a question about the data handling. I have a dataset as following: ID snp1 snp2 snp3 1001 0/0 1/1 1/1 1002 2/2 3/3 1/1 1003 4/4 3/3 2/2 I want to convert the dataset to the following format: ID snp1 snp2 snp3 1001 00 AA AA 1002 GG
2011 Jul 21
4
Random number generation
Hi, I want to generate multiple sets of random numbers. The requirement is that: 1) each set have 3 random numbers; 2) the sum of the three number is always 1. how to do this? thank you, karena -- View this message in context: http://r.789695.n4.nabble.com/Random-number-generation-tp3685463p3685463.html Sent from the R help mailing list archive at Nabble.com.
2010 May 05
4
any function in R similar to the "scan" function in SAS?
I am wondering if there is any function in R that is similar to the "scan" function in SAS. I have a data.frame which has two columns as the following: one two 1 2 3 4 5 6 I used the "paste" function to create the third column: three <- paste(one,'-',two,sep="") so the data.frame is like this now: one two three 1 2 1-2 3
2010 Apr 22
6
macro variable in R?
I need to create 10 matrices. say matrix 1-10. matrix_1 is 1 by 1 matrix_2 is 2 by 2 matrix_3 is 3 by 3 . . . matrix_10 is 10 by 10 I am just wondering if there are some functions in R that are similar to the macro variables in SAS. so I can create these 10 matrices by doing: for (i in 1: 10) { matrix_$i <- matrix(nrow=i, ncol=i) } rather thank creating these matrices one by one
2011 Oct 19
2
A questions regarding R plots
Hi Dear all, I am making Venn Diagram plots in R. I attached an example: http://r.789695.n4.nabble.com/file/n3919206/venn.jpeg I want to get rid of the black boarder line, is there any way to do it? Thank you very much, Karena -- View this message in context: http://r.789695.n4.nabble.com/A-questions-regarding-R-plots-tp3919206p3919206.html Sent from the R help mailing list archive at
2010 May 04
2
question about 'write.table'
I have a question about the "write.table" I have 100 data.frames, loci1, loci2, loci3.............,loci100. now, I want to print these data.frames to 100 separate files, and the names of the files are also loci1, loci2, loci3,......., loci100. how to perform this under a "for" loop? say, for (i in 1:100) { write.table(...., file='...', ........) } thank you,
2010 Jan 13
4
a question about deleting rows
I have a file like this: id n1 n2 n3 n4 n5 n6 1 3 4 7 8 10 2 2 4 1 2 4 3 10 3 7 0 0 0 0 8 4 10 1 0 0 2 3 5 11 1 0 0 0 5 what I want to do is: only if n2=0 and n3=0 and n4=0 and n5=0 then delete the row. how can I do that? thank you, karena -- View this message
2010 Jan 12
2
how to handle missing values "." when importing data in R
hi, I have a question about importing data in R. I want to import a file which has missing value in it, and the missing values are denoted as ".", I want to first read in the file, and then change the "." into the number zero "0". how can I do that? thank you, karena -- View this message in context:
2010 Nov 02
2
how to make multiple curves in one plot
hello, plot(running(-log10(results_chr_p$empi_p), fun=mean, width=41, font.axis=4, by=1),type="l",cex=0.1, ylab="-Log(p)", ylim=c(0,5.0), xlab=" ", lwd=2) this is my code to make a plot. The problem is, now I want to add one more curve to the plot, which is for another variable in the data.frame -log10(results_chr_p$p). My question is: how to make multiple lines
2010 Jul 16
2
a issue about the qutation mark?
Following is a function that I wrote (It is working well). It's a simple one, nothing complicated. The only question that I have is a qutation mark issue, I guess. ############################################# funcname <- function(trait.file){ #line1 setwd('/root/subroot') # line 2 load('imge.RData')
2010 Jun 03
5
string handling
I have a data.frame as the following: var1 var2 9G/G09 abd89C/T90 10A/T9 32C/C 90G/G A/A . . . . . . 10T/C 00G/G90 What I want is to get the letters which are on the left and right of '/'. for example, for "9G/G09", I only want "G", "G", and for "abd89C/T90", I only want "C" and
2010 Sep 08
2
a question about replacing the value in the data.frame
I have a data.frame as follows: v1 v2 v3 v4 v5.....v100 1 1 0 0 1 2 2 1 2 1 0 1 1 1 1 2 1 0 . . . . . . . . . . . . 1 2 2 1 1 0 so for this data set, what I wanna do is to replace all the
2011 Jun 13
1
Convert SAS code to R code about survival analysis
Hi, I am working on transforming a SAS code to R code. It's about the survival analysis and the SAS code is as below: -------------------------------------- proc lifetest data=surdata plot=(s); time surv*censht(1); strata educ; title 'Day 1 homework'; run; ---------------------------------------- here is the data: subject surv censht educ 1 78 1 1 2
2010 Jul 14
4
question about string handling....
Hi, I have a data.frame as following: var1 var2 1 ab_c_(ok) 2 okf789(db)_c 3 jojfiod(90).gt 4 "ij"_(78)__op 5 (iojfodjfo)_ab what I want is to create a new variable called "var3". the value of var3 is the content in the Parentheses. so var3 would be: var3 ok db 90 78 iojfodjfo how to do this? thanks, karena --
2012 Mar 07
2
fill=T?
If a text file has rows of variable lengths. How to read the file into R? I think some people may suggest using 'fill=T', however, it sort of messes the data up, for example, in the text file: a b c d 1 2 3 4 1 8 6 1 2 0 1 1 0 If I read in the file using 'read.table("data", head=T, fill=T), then the data.frame in R will
2010 Aug 05
2
a question about 'read.table' with or without 'read.table'.(urgent)
Hi, I've got a quite tricky question. I have a txt file, named 'temp.txt', as the following: snp1 snp2 snp3 AA 00 00 GG GG 00 00 AA 00 I want to read the file into R. 1) when I use 'read.table' without 'header=T' option, > temp <- read.table('temp.txt') # I got > temp V1
2011 Sep 14
1
Questons about 'igraph' package
Hi, I am using 'igraph' to make some plots. The problem I got is that I don't know how to label the nodes with gene names. My sample code: ## suppose I have 100 gene (nodes) ## --------------------------------------------------------------------------- graph <- set.vertex.attribute(graph, "color", value=c(rep(c('green','red'),50))) graph <-
2010 Aug 31
1
any statement equals to 'goto'?
I have the following code: ----------------------------------------------------------------------------------------------------- result <- matrix(NA, nrow=1, ncol=5) for(i in 1:(nsnp-1)) { for(j in (i+1):nsnp){ tempsnp1 <- data.lme[,i] tempsnp2 <- data.lme[,j] fm1 <- lme(trait~sex+age+rmtemp.b+fc+tempsnp1+tempsnp2+tempsnp1*tempsnp2, random=~1|famid, na.action=na.omit) fm2 <-
2011 Sep 20
1
A question regarding random effects in 'aov' function
Hi, I am doing an analysis to see if these is tissue specific effects on the gene expression data . Our data were collected from 6 different labs (batch effects). lab 1 has tissue type 1 and tissue type 2, lab 2 has tissue 3, 4,5,6. The other labs has one tissue type each. The 'sample' data is as below: