Displaying 20 results from an estimated 200 matches similar to: "regression function for categorical predictor data"
2011 Jun 15
4
R string functions
Hi,
I have a string "GGGGGGCCCAATCGCAATTCCAATT"
What I want to do is to count the percentage of each letter in the string,
what string functions can I use to count the number of each letter appearing
in the string?
For example, the letter "A" appeared 6 times, letter "T" appeared 5 times,
how can I use a string function to get the these number?
thanks,
karena
2010 Aug 05
2
questions about string handling
Hi, I have a question about the data handling. I have a dataset as following:
ID snp1 snp2 snp3
1001 0/0 1/1 1/1
1002 2/2 3/3 1/1
1003 4/4 3/3 2/2
I want to convert the dataset to the following format:
ID snp1 snp2 snp3
1001 00 AA AA
1002 GG
2011 Jul 21
4
Random number generation
Hi,
I want to generate multiple sets of random numbers.
The requirement is that:
1) each set have 3 random numbers;
2) the sum of the three number is always 1.
how to do this?
thank you,
karena
--
View this message in context: http://r.789695.n4.nabble.com/Random-number-generation-tp3685463p3685463.html
Sent from the R help mailing list archive at Nabble.com.
2010 May 05
4
any function in R similar to the "scan" function in SAS?
I am wondering if there is any function in R that is similar to the "scan"
function in SAS.
I have a data.frame which has two columns as the following:
one two
1 2
3 4
5 6
I used the "paste" function to create the third column: three <-
paste(one,'-',two,sep="")
so the data.frame is like this now:
one two three
1 2 1-2
3
2010 Apr 22
6
macro variable in R?
I need to create 10 matrices. say matrix 1-10.
matrix_1 is 1 by 1
matrix_2 is 2 by 2
matrix_3 is 3 by 3
.
.
.
matrix_10 is 10 by 10
I am just wondering if there are some functions in R that are similar to the
macro variables in SAS. so I can create these 10 matrices by doing:
for (i in 1: 10) {
matrix_$i <- matrix(nrow=i, ncol=i)
}
rather thank creating these matrices one by one
2011 Oct 19
2
A questions regarding R plots
Hi Dear all,
I am making Venn Diagram plots in R. I attached an example:
http://r.789695.n4.nabble.com/file/n3919206/venn.jpeg
I want to get rid of the black boarder line, is there any way to do it?
Thank you very much,
Karena
--
View this message in context: http://r.789695.n4.nabble.com/A-questions-regarding-R-plots-tp3919206p3919206.html
Sent from the R help mailing list archive at
2010 May 04
2
question about 'write.table'
I have a question about the "write.table"
I have 100 data.frames, loci1, loci2, loci3.............,loci100.
now, I want to print these data.frames to 100 separate files, and the names
of the files are also loci1, loci2, loci3,......., loci100.
how to perform this under a "for" loop?
say,
for (i in 1:100) {
write.table(...., file='...', ........)
}
thank you,
2010 Jan 13
4
a question about deleting rows
I have a file like this:
id n1 n2 n3 n4 n5 n6
1 3 4 7 8 10 2
2 4 1 2 4 3 10
3 7 0 0 0 0 8
4 10 1 0 0 2 3
5 11 1 0 0 0 5
what I want to do is: only if n2=0 and n3=0 and n4=0 and n5=0 then delete
the row. how can I do that?
thank you,
karena
--
View this message
2010 Jan 12
2
how to handle missing values "." when importing data in R
hi, I have a question about importing data in R.
I want to import a file which has missing value in it, and the missing
values are denoted as ".", I want to first read in the file, and then change
the "." into the number zero "0".
how can I do that?
thank you,
karena
--
View this message in context:
2010 Nov 02
2
how to make multiple curves in one plot
hello,
plot(running(-log10(results_chr_p$empi_p), fun=mean, width=41, font.axis=4,
by=1),type="l",cex=0.1, ylab="-Log(p)", ylim=c(0,5.0), xlab=" ", lwd=2)
this is my code to make a plot. The problem is, now I want to add one more
curve to the plot, which is for another variable in the data.frame
-log10(results_chr_p$p). My question is: how to make multiple lines
2010 Jul 16
2
a issue about the qutation mark?
Following is a function that I wrote (It is working well). It's a simple one,
nothing complicated. The only question that I have is a qutation mark issue,
I guess.
#############################################
funcname <- function(trait.file){ #line1
setwd('/root/subroot') # line 2
load('imge.RData')
2010 Jun 03
5
string handling
I have a data.frame as the following:
var1 var2
9G/G09 abd89C/T90
10A/T9 32C/C
90G/G A/A
. .
. .
. .
10T/C 00G/G90
What I want is to get the letters which are on the left and right of '/'.
for example, for "9G/G09", I only want "G", "G", and for "abd89C/T90", I
only want "C" and
2010 Sep 08
2
a question about replacing the value in the data.frame
I have a data.frame as follows:
v1 v2 v3 v4 v5.....v100
1 1 0 0 1 2
2 1 2 1 0 1
1 1 1 2 1 0
. . . . . .
. . . . . .
1 2 2 1 1 0
so for this data set, what I wanna do is to replace all the
2011 Jun 13
1
Convert SAS code to R code about survival analysis
Hi, I am working on transforming a SAS code to R code.
It's about the survival analysis and the SAS code is as below:
--------------------------------------
proc lifetest data=surdata plot=(s);
time surv*censht(1);
strata educ;
title 'Day 1 homework';
run;
----------------------------------------
here is the data:
subject surv censht educ
1 78 1 1
2
2010 Jul 14
4
question about string handling....
Hi,
I have a data.frame as following:
var1 var2
1 ab_c_(ok)
2 okf789(db)_c
3 jojfiod(90).gt
4 "ij"_(78)__op
5 (iojfodjfo)_ab
what I want is to create a new variable called "var3". the value of var3 is
the content in the Parentheses. so var3 would be:
var3
ok
db
90
78
iojfodjfo
how to do this?
thanks,
karena
--
2012 Mar 07
2
fill=T?
If a text file has rows of variable lengths. How to read the file into R?
I think some people may suggest using 'fill=T', however, it sort of messes
the data up, for example, in the text file:
a b c d
1 2 3 4
1 8 6
1 2 0
1 1 0
If I read in the file using 'read.table("data", head=T, fill=T), then the
data.frame in R will
2010 Aug 05
2
a question about 'read.table' with or without 'read.table'.(urgent)
Hi, I've got a quite tricky question.
I have a txt file, named 'temp.txt', as the following:
snp1 snp2 snp3
AA 00 00
GG GG 00
00 AA 00
I want to read the file into R.
1) when I use 'read.table' without 'header=T' option,
> temp <- read.table('temp.txt')
# I got
> temp
V1
2011 Sep 14
1
Questons about 'igraph' package
Hi,
I am using 'igraph' to make some plots. The problem I got is that I don't
know how to label the nodes with gene names.
My sample code:
## suppose I have 100 gene (nodes) ##
---------------------------------------------------------------------------
graph <- set.vertex.attribute(graph, "color",
value=c(rep(c('green','red'),50)))
graph <-
2010 Aug 31
1
any statement equals to 'goto'?
I have the following code:
-----------------------------------------------------------------------------------------------------
result <- matrix(NA, nrow=1, ncol=5)
for(i in 1:(nsnp-1)) {
for(j in (i+1):nsnp){
tempsnp1 <- data.lme[,i]
tempsnp2 <- data.lme[,j]
fm1 <- lme(trait~sex+age+rmtemp.b+fc+tempsnp1+tempsnp2+tempsnp1*tempsnp2,
random=~1|famid, na.action=na.omit)
fm2 <-
2011 Sep 20
1
A question regarding random effects in 'aov' function
Hi,
I am doing an analysis to see if these is tissue specific effects on the
gene expression data .
Our data were collected from 6 different labs (batch effects). lab 1 has
tissue type 1 and tissue type 2, lab 2 has tissue 3, 4,5,6. The other labs
has one tissue type each. The 'sample' data is as below: