similar to: a question about replacing the value in the data.frame

Following is a function that I wrote (It is working well). It's a simple one, nothing complicated. The only question that I have is a qutation mark issue, I guess. ############################################# funcname <- function(trait.file){ #line1 setwd('/root/subroot') # line 2 load('imge.RData')

I have a file like this: id n1 n2 n3 n4 n5 n6 1 3 4 7 8 10 2 2 4 1 2 4 3 10 3 7 0 0 0 0 8 4 10 1 0 0 2 3 5 11 1 0 0 0 5 what I want to do is: only if n2=0 and n3=0 and n4=0 and n5=0 then delete the row. how can I do that? thank you, karena -- View this message

Hi, I have a data.frame as following: var1 var2 1 ab_c_(ok) 2 okf789(db)_c 3 jojfiod(90).gt 4 "ij"_(78)__op 5 (iojfodjfo)_ab what I want is to create a new variable called "var3". the value of var3 is the content in the Parentheses. so var3 would be: var3 ok db 90 78 iojfodjfo how to do this? thanks, karena --

I need to create 10 matrices. say matrix 1-10. matrix_1 is 1 by 1 matrix_2 is 2 by 2 matrix_3 is 3 by 3 . . . matrix_10 is 10 by 10 I am just wondering if there are some functions in R that are similar to the macro variables in SAS. so I can create these 10 matrices by doing: for (i in 1: 10) { matrix_$i <- matrix(nrow=i, ncol=i) } rather thank creating these matrices one by one

Hi Dear all, I am making Venn Diagram plots in R. I attached an example: http://r.789695.n4.nabble.com/file/n3919206/venn.jpeg I want to get rid of the black boarder line, is there any way to do it? Thank you very much, Karena -- View this message in context: http://r.789695.n4.nabble.com/A-questions-regarding-R-plots-tp3919206p3919206.html Sent from the R help mailing list archive at

I have a question about the "write.table" I have 100 data.frames, loci1, loci2, loci3.............,loci100. now, I want to print these data.frames to 100 separate files, and the names of the files are also loci1, loci2, loci3,......., loci100. how to perform this under a "for" loop? say, for (i in 1:100) { write.table(...., file='...', ........) } thank you,

Hi, I have a question about the data handling. I have a dataset as following: ID snp1 snp2 snp3 1001 0/0 1/1 1/1 1002 2/2 3/3 1/1 1003 4/4 3/3 2/2 I want to convert the dataset to the following format: ID snp1 snp2 snp3 1001 00 AA AA 1002 GG

Hi, I've got a quite tricky question. I have a txt file, named 'temp.txt', as the following: snp1 snp2 snp3 AA 00 00 GG GG 00 00 AA 00 I want to read the file into R. 1) when I use 'read.table' without 'header=T' option, > temp <- read.table('temp.txt') # I got > temp V1

I have a data.frame as the following: var1 var2 9G/G09 abd89C/T90 10A/T9 32C/C 90G/G A/A . . . . . . 10T/C 00G/G90 What I want is to get the letters which are on the left and right of '/'. for example, for "9G/G09", I only want "G", "G", and for "abd89C/T90", I only want "C" and

Hi, I want to generate multiple sets of random numbers. The requirement is that: 1) each set have 3 random numbers; 2) the sum of the three number is always 1. how to do this? thank you, karena -- View this message in context: http://r.789695.n4.nabble.com/Random-number-generation-tp3685463p3685463.html Sent from the R help mailing list archive at Nabble.com.

hi, I have a question about importing data in R. I want to import a file which has missing value in it, and the missing values are denoted as ".", I want to first read in the file, and then change the "." into the number zero "0". how can I do that? thank you, karena -- View this message in context:

Hi, I have a string "GGGGGGCCCAATCGCAATTCCAATT" What I want to do is to count the percentage of each letter in the string, what string functions can I use to count the number of each letter appearing in the string? For example, the letter "A" appeared 6 times, letter "T" appeared 5 times, how can I use a string function to get the these number? thanks, karena

hello, plot(running(-log10(results_chr_p$empi_p), fun=mean, width=41, font.axis=4, by=1),type="l",cex=0.1, ylab="-Log(p)", ylim=c(0,5.0), xlab=" ", lwd=2) this is my code to make a plot. The problem is, now I want to add one more curve to the plot, which is for another variable in the data.frame -log10(results_chr_p$p). My question is: how to make multiple lines

I am wondering if there is any function in R that is similar to the "scan" function in SAS. I have a data.frame which has two columns as the following: one two 1 2 3 4 5 6 I used the "paste" function to create the third column: three <- paste(one,'-',two,sep="") so the data.frame is like this now: one two three 1 2 1-2 3

If a text file has rows of variable lengths. How to read the file into R? I think some people may suggest using 'fill=T', however, it sort of messes the data up, for example, in the text file: a b c d 1 2 3 4 1 8 6 1 2 0 1 1 0 If I read in the file using 'read.table("data", head=T, fill=T), then the data.frame in R will

Hi, I am using 'igraph' to make some plots. The problem I got is that I don't know how to label the nodes with gene names. My sample code: ## suppose I have 100 gene (nodes) ## --------------------------------------------------------------------------- graph <- set.vertex.attribute(graph, "color", value=c(rep(c('green','red'),50))) graph <-

Hi, I am doing an analysis to see if these is tissue specific effects on the gene expression data . Our data were collected from 6 different labs (batch effects). lab 1 has tissue type 1 and tissue type 2, lab 2 has tissue 3, 4,5,6. The other labs has one tissue type each. The 'sample' data is as below:

Hi, I am new to R. My question is: how to get the 'hazard ratio' using the 'coxph' function in 'survival' package? thanks, karena -- View this message in context: http://r.789695.n4.nabble.com/About-hazard-ratio-urgent-tp3595527p3595527.html Sent from the R help mailing list archive at Nabble.com.

Hi Dear all, I have some gene expression data samples from different tissue types ----------------------------------------------- - 120 samples from blood (B) - 20 samples from Liver (L) - 15 samples from Kidney (K) - 6 samples from heart (H) ----------------------------------------------- All the samples are from different individuals, so there are in total 161 individuals from which the DNA was

Hi, I have a question about how to do covariate adjustment. I have two sets of 'gene expression' data. They are from two different tissue types, 'liver' and 'brain', respectively. The purpose of my analysis is to compare the pattern of the whole genome 'gene expression' between the two tissue types. I have 'age' and 'sex' as covariates. Since