similar to: Subsetting Data Frame based On Specified K Value

Dear masters, I have data that looks like this: #val Freq1 Freq2 0.000 178 202 0.001 4611 5300 0.002 99 112 0.003 26 30 0.004 17 20 0.005 15 20 0.006 11 14 0.007 11 13 0.008 13 13 ...many more lines.. Full data can be found here: http://dpaste.com/173536/plain/ What I intend to do is to have a cumulative graph with "val" as x-axis with "Freq1" & "Freq2" as

I have a data that looks like this: http://dpaste.com/88561/plain/ And I intend to create multiple density curve into one plot, where each curve correspond to the unique ID. I tried to use "sm" package, with this code, but without success. __BEGIN__ library(sm) dat <- read.table("mydat.txt"); plotfn <- ("~/Desktop/flowgram_superimposed.pdf"); pdf(plotfn);

Hi, I have the following dataset (simplified for example). __DATA__ 300.35 200.25 104.30 22.00 31.12 89.99 444.50 22.10 43.00 22.10 200.55 66.77 Now from that I wish to do the following: 1. Compute variance of each row 2. Pick top-2 row with highest variance 3. Store those selected rows for further processing To achieve this, I tried to: a) read the table and compute variance for each row,

Greetings. I have an image I've created with a bunch of chost flags which works on my machine when it comes to native boot. if I take that same image into a vm managed via libvirt, I get kernel panic. I'd assume that something is missing from my vm config, question is what and what I can do about it? here is the flags part of lscpu in native and vm: https://dpaste.com/3TR8QJ5G8 and the

Hi all, Suppose I have 2 matrices A and B. And I want to measure how good each of this matrix is. So I intend to compare A and B with another "gold standard" matrix X. Meaning the more similar a matrix to X the better it is. What is the common way in R to measure matrix similarity (ie. A vs X, and B vs X) ? - Gundala Viswanath Jakarta - Indonesia

Hi, I have the following vector which is created from 3 distinct distribution (three components) of gamma: x=c(rgamma(30,shape=.2,scale=14),rgamma(30,shape=12,scale=10),rgamma(30,shape=5,scale=6)) I want to plot the density curve of X, in a way that it shows a distinct 3 curves that represent each component. How can I do that? I tried this but doesn't work: lines(density(x)) Please

Hi, I''m tying to load a full HVM enviroment with windows XP to test my first xen VM. This is my config file http://dpaste.org/pbJd/ <http://dpaste.org/pbJd/>when i run the command : xm create winxp.cfg i got Error: Domain ''winXP'' does not exist. Somebody can help me with this? i did read docs about config files, everyting seems to be in place thanks --

Hi Dieter, Sorry my mistake. I wanted to convert them into Decimal (not Hexadecimal). Given this string, the desired answer follows: > ascii_str <- "ORQ>IK" 79 82 81 62 73 75 > ascii_str2 <- "FDC" 70 68 67 - Gundala Viswanath Jakarta - Indonesia On Mon, Dec 22, 2008 at 5:49 PM, Dieter Menne <dieter.menne at menne-biomed.de> wrote: > Gundala

Hi, I have the following (M x N) matrix, where M = 10 and N =2 What I intend to do is to group index of (M) based on this condition of "x_mn" , namely For each M, If x_m1 > x_m2, assign index of M to Group1 otherwise assign index of M into Group 2 > x [,1] [,2] [1,] 4.482909e-01 0.55170907 [2,] 9.479594e-01 0.05204063 [3,] 8.923553e-01 0.10764474

Dear all, I have the following matrix. > dat A A A A A A A A A A [1,] 0 0 0 0 0 0 0 0 0 0 [2,] 0 0 0 0 0 0 0 0 0 1 [3,] 0 0 0 0 0 0 0 0 0 2 How can I change it into: [,1] [,2] [,3] [,4] [,5] [,6] [,7] [,8] [,9] [,10] [1,] 0 0 0 0 0 0 0 0 0 0 [2,] 0 0 0 0 0 0 0 0 0 1

Hi, How can I extract the label only from a given data frame. Fore example from this data frame. > print(dataf) V1 V2 V3 V4 V5 V6 V7 V8 V9 11145 14.3 17.1 31.2 41.7 45.8 49.8 68.6 70.6 72.9 3545 10.2 15.6 20.9 23.2 31.4 31.7 36.2 48.4 51.9 8951 15.2 17.5 20.0 21.4 32.4

Greetings, I have the following machine: https://dpaste.com/5BPA3F77F which I'm trying to boot in uefi. /etc/libvirt/qemu.conf looks like this: https://dpaste.com/B3SFHUY6R and the ovmf files exists in the path, see: # ll /usr/share/edk2-ovmf/OVMF_CODE.fd /usr/share/edk2-ovmf/OVMF_VARS.fd /usr/share/edk2-ovmf/OVMF_CODE.secboot.fd /usr/share/edk2-ovmf/OVMF_VARS.secboot.fd -rw-r--r-- 1 root

Dear all, Suppose I have this data frame: > data_main V1 V2 foo 13.1 bar 12.0 qux 10.4 cho 20.33 pox 8.21 And I want to split the data into two parts first part are the one contain in the source array: > src [1] "bar" "pox" and the other one the complement. In the end we hope to get this two dataframes: > data_child1 V1 V2 bar 13.1 pox

Hi all, Suppose I hve this vector: > x [1] 3 4 7 17 22 12 15 12 3 3 1 1 How can I remove the top-3 element. Yielding only: [1] 17 22 12 15 12 3 3 1 1 - Gundala Viswanath Jakarta - Indonesia

I have the following data frame: > foo w x y z n 1.51550092 1.4337572 1.2791624 1.1771230 q 0.09977303 0.8173761 1.6123402 0.1510737 r 1.17083866 1.2469347 0.8712135 0.8488029 What I want to do is to change it into : > newdf 1 n w 1.51550092 2 q w 0.09977303 3 r w 1.17083866 4 n x 1.43375725 5 q x 0.81737606 6 r x

Dear all, For example I want to process set of files. Typically Perl's idiom would be: __BEGIN__ @files = glob("/mydir/*.txt"); foreach my $file (@files) { # process the file } __END__ What's the R's way to do that? - Gundala Viswanath Jakarta - Indonesia

Dear all, The basename() function returns the extension also: > myfile <- "path1/path2/myoutput.txt" > basename(myfile) [1] "myoutput.txt" Is there any other function where it just returns plain base: "myoutput" i.e. without 'txt' - Gundala Viswanath Jakarta - Indonesia

Dear all, What's the R way to compress the string into smaller 2~3 char/digit length. In particular I want to compress string of length >=30 characters, e.g. ACGATACGGCGACCACCGAGATCTACACTCTTCC The reason I want to do that is because, there are billions of such string I want to print out. And I need to save disk space. - Gundala Viswanath Jakarta - Indonesia

Hi, How can I partitioned an example vector like this > print(myvector) [1] 30.9 60.1 70.0 73.0 75.0 83.9 93.1 97.6 98.8 113.9 into the following pairwise partition: PAIR1 part1 = 30.9 part2 = 60.1 70.0 73.0 75.0 83.9 93.1 97.6 98.8 113.9 PAIR2 part1 = 30.9 60.1 part2 = 70.0 73.0 75.0 83.9 93.1 97.6 98.8 113.9 .... PAIR9 part1 = 30.9

Hi all, Given a matrix: > mat [,1] [,2] [,3] [1,] 0 0 0 [2,] 3 3 3 [3,] 1 1 1 [4,] 2 1 1 How can I convert it to a list of strings: > desired_output [1] "aaa" "ttt" "ccc" "gcc" In principle: 1. Number of Column in matrix = length of string (= 3) 2. Number of Row in matrix = length of vector ( = 4). 3.