similar to: Subsetting Data Frame based On Specified K Value

Displaying 20 results from an estimated 6000 matches similar to: "Subsetting Data Frame based On Specified K Value"

2010 Mar 19
1
How to plot two cumulative frequency graph together
Dear masters, I have data that looks like this: #val Freq1 Freq2 0.000 178 202 0.001 4611 5300 0.002 99 112 0.003 26 30 0.004 17 20 0.005 15 20 0.006 11 14 0.007 11 13 0.008 13 13 ...many more lines.. Full data can be found here: http://dpaste.com/173536/plain/ What I intend to do is to have a cumulative graph with "val" as x-axis with "Freq1" & "Freq2" as
2009 Sep 02
1
Howto Superimpose Multiple Density Curves Into One Plot
I have a data that looks like this: http://dpaste.com/88561/plain/ And I intend to create multiple density curve into one plot, where each curve correspond to the unique ID. I tried to use "sm" package, with this code, but without success. __BEGIN__ library(sm) dat <- read.table("mydat.txt"); plotfn <- ("~/Desktop/flowgram_superimposed.pdf"); pdf(plotfn);
2008 Jun 19
2
Create Matrix from Loop of Vectors, Sort It and Pick Top-K
Hi, I have the following dataset (simplified for example). __DATA__ 300.35 200.25 104.30 22.00 31.12 89.99 444.50 22.10 43.00 22.10 200.55 66.77 Now from that I wish to do the following: 1. Compute variance of each row 2. Pick top-2 row with highest variance 3. Store those selected rows for further processing To achieve this, I tried to: a) read the table and compute variance for each row,
2020 Nov 17
2
image works in native but not in vm when cpu mode='host-passthrough' is set
Greetings. I have an image I've created with a bunch of chost flags which works on my machine when it comes to native boot. if I take that same image into a vm managed via libvirt, I get kernel panic. I'd assume that something is missing from my vm config, question is what and what I can do about it? here is the flags part of lscpu in native and vm: https://dpaste.com/3TR8QJ5G8 and the
2008 Jun 24
5
Measuring Goodness of a Matrix
Hi all, Suppose I have 2 matrices A and B. And I want to measure how good each of this matrix is. So I intend to compare A and B with another "gold standard" matrix X. Meaning the more similar a matrix to X the better it is. What is the common way in R to measure matrix similarity (ie. A vs X, and B vs X) ? - Gundala Viswanath Jakarta - Indonesia
2008 Jul 07
4
Plot Mixtures of Synthetically Generated Gamma Distributions
Hi, I have the following vector which is created from 3 distinct distribution (three components) of gamma: x=c(rgamma(30,shape=.2,scale=14),rgamma(30,shape=12,scale=10),rgamma(30,shape=5,scale=6)) I want to plot the density curve of X, in a way that it shows a distinct 3 curves that represent each component. How can I do that? I tried this but doesn't work: lines(density(x)) Please
2010 Sep 01
2
Error: Domain ''winXP'' does not exist.
Hi, I''m tying to load a full HVM enviroment with windows XP to test my first xen VM. This is my config file http://dpaste.org/pbJd/ <http://dpaste.org/pbJd/>when i run the command : xm create winxp.cfg i got Error: Domain ''winXP'' does not exist. Somebody can help me with this? i did read docs about config files, everyting seems to be in place thanks --
2008 Dec 22
3
Convert ASCII string to Decimal in R (vice versa) was: Hex
Hi Dieter, Sorry my mistake. I wanted to convert them into Decimal (not Hexadecimal). Given this string, the desired answer follows: > ascii_str <- "ORQ>IK" 79 82 81 62 73 75 > ascii_str2 <- "FDC" 70 68 67 - Gundala Viswanath Jakarta - Indonesia On Mon, Dec 22, 2008 at 5:49 PM, Dieter Menne <dieter.menne at menne-biomed.de> wrote: > Gundala
2008 Aug 01
3
Grouping Index of Matrix Based on Certain Condition
Hi, I have the following (M x N) matrix, where M = 10 and N =2 What I intend to do is to group index of (M) based on this condition of "x_mn" , namely For each M, If x_m1 > x_m2, assign index of M to Group1 otherwise assign index of M into Group 2 > x [,1] [,2] [1,] 4.482909e-01 0.55170907 [2,] 9.479594e-01 0.05204063 [3,] 8.923553e-01 0.10764474
2009 Jan 06
5
Changing Matrix Header
Dear all, I have the following matrix. > dat A A A A A A A A A A [1,] 0 0 0 0 0 0 0 0 0 0 [2,] 0 0 0 0 0 0 0 0 0 1 [3,] 0 0 0 0 0 0 0 0 0 2 How can I change it into: [,1] [,2] [,3] [,4] [,5] [,6] [,7] [,8] [,9] [,10] [1,] 0 0 0 0 0 0 0 0 0 0 [2,] 0 0 0 0 0 0 0 0 0 1
2008 Jun 23
3
Getting only label column of a data frame
Hi, How can I extract the label only from a given data frame. Fore example from this data frame. > print(dataf) V1 V2 V3 V4 V5 V6 V7 V8 V9 11145 14.3 17.1 31.2 41.7 45.8 49.8 68.6 70.6 72.9 3545 10.2 15.6 20.9 23.2 31.4 31.7 36.2 48.4 51.9 8951 15.2 17.5 20.0 21.4 32.4
2020 Oct 12
4
unable to find any master var store for loader error
Greetings, I have the following machine: https://dpaste.com/5BPA3F77F which I'm trying to boot in uefi. /etc/libvirt/qemu.conf looks like this: https://dpaste.com/B3SFHUY6R and the ovmf files exists in the path, see: # ll /usr/share/edk2-ovmf/OVMF_CODE.fd /usr/share/edk2-ovmf/OVMF_VARS.fd /usr/share/edk2-ovmf/OVMF_CODE.secboot.fd /usr/share/edk2-ovmf/OVMF_VARS.secboot.fd -rw-r--r-- 1 root
2008 Sep 09
3
Splitting Data Frame into Two Based on Source Array
Dear all, Suppose I have this data frame: > data_main V1 V2 foo 13.1 bar 12.0 qux 10.4 cho 20.33 pox 8.21 And I want to split the data into two parts first part are the one contain in the source array: > src [1] "bar" "pox" and the other one the complement. In the end we hope to get this two dataframes: > data_child1 V1 V2 bar 13.1 pox
2009 Feb 18
2
Remove top-K elements in Vector
Hi all, Suppose I hve this vector: > x [1] 3 4 7 17 22 12 15 12 3 3 1 1 How can I remove the top-3 element. Yielding only: [1] 17 22 12 15 12 3 3 1 1 - Gundala Viswanath Jakarta - Indonesia
2013 Feb 01
3
Transforming 4x3 data frame into 2 column df in R
I have the following data frame: > foo w x y z n 1.51550092 1.4337572 1.2791624 1.1771230 q 0.09977303 0.8173761 1.6123402 0.1510737 r 1.17083866 1.2469347 0.8712135 0.8488029 What I want to do is to change it into : > newdf 1 n w 1.51550092 2 q w 0.09977303 3 r w 1.17083866 4 n x 1.43375725 5 q x 0.81737606 6 r x
2008 Dec 21
3
Globbing Files in R
Dear all, For example I want to process set of files. Typically Perl's idiom would be: __BEGIN__ @files = glob("/mydir/*.txt"); foreach my $file (@files) { # process the file } __END__ What's the R's way to do that? - Gundala Viswanath Jakarta - Indonesia
2009 Jan 09
4
Extracting File Basename without Extension
Dear all, The basename() function returns the extension also: > myfile <- "path1/path2/myoutput.txt" > basename(myfile) [1] "myoutput.txt" Is there any other function where it just returns plain base: "myoutput" i.e. without 'txt' - Gundala Viswanath Jakarta - Indonesia
2008 Dec 24
2
Compressing String in R
Dear all, What's the R way to compress the string into smaller 2~3 char/digit length. In particular I want to compress string of length >=30 characters, e.g. ACGATACGGCGACCACCGAGATCTACACTCTTCC The reason I want to do that is because, there are billions of such string I want to print out. And I need to save disk space. - Gundala Viswanath Jakarta - Indonesia
2008 Jun 23
2
Pairwise Partitioning of a Vector
Hi, How can I partitioned an example vector like this > print(myvector) [1] 30.9 60.1 70.0 73.0 75.0 83.9 93.1 97.6 98.8 113.9 into the following pairwise partition: PAIR1 part1 = 30.9 part2 = 60.1 70.0 73.0 75.0 83.9 93.1 97.6 98.8 113.9 PAIR2 part1 = 30.9 60.1 part2 = 70.0 73.0 75.0 83.9 93.1 97.6 98.8 113.9 .... PAIR9 part1 = 30.9
2009 Jan 11
3
Converting Numerical Matrix to List of Strings
Hi all, Given a matrix: > mat [,1] [,2] [,3] [1,] 0 0 0 [2,] 3 3 3 [3,] 1 1 1 [4,] 2 1 1 How can I convert it to a list of strings: > desired_output [1] "aaa" "ttt" "ccc" "gcc" In principle: 1. Number of Column in matrix = length of string (= 3) 2. Number of Row in matrix = length of vector ( = 4). 3.