similar to: permutation test assumption?

Dear all, I would like to know how can I create a binned column in a data.frame. The output that I would like is something like this: Start Binned_Start 1 0-5 2 0-5 6 5-10 8 5-10 13 10-15 ... Best regards João Fadista Ph.d. student UNIVERSITY OF AARHUS Faculty of Agricultural Sciences Dept. of Genetics and Biotechnology Blichers

Dear all, I would like to know how can I retrieve a data.frame without the columns that have a partial match name. Let´s say that I have a data.frame with 200 columns and 100 of them have the name "StartX", with X being the unique part for each column name. I want to delete all columns that have the name starting with "Start". I´ve tried to do this but it doesn´t work: >

Dear all, I would like to know how can I concatenate 2 data.frames into a single one. Both data frames have the same number of columns and the same class type in each correspondent column. So what I want is to have a new data.frame where I have first the values from one data.frame and then the values from a second data.frame would came after in this new data.frame. Thanks in advance. Med

Dear all, I would like to know if I can compare by a significance test 2 models with different kind of parameters. Perhaps I am wrong but I think that we can only compare 2 models if one is a sub model of the other. Med venlig hilsen / Regards João Fadista Ph.d. studerende / Ph.d. student AARHUS UNIVERSITET / UNIVERSITY OF AARHUS Det Jordbrugsvidenskabelige Fakultet / Faculty of

Dear all, I would like to know if there is any R package that uses a sliding window approach to assess statistical significance out of my data. My data is composed of DNA sequences (of variable length) that are mapped to a genome with a determined score of alignment. So, I want to see if I can find more tags in a given region of the genome as opposed to finding them by chance. In this sliding

Dear all, I have the positions of N points spread through some sequence of length L (L>N), and I would like to know how can do the following: 1- Permute the positions of the N points along the whole sequence. Assuming a uniform distribution I did: position1 <- runif(N, 1, L) 2- Apply a kernel convolution method to the resulting permuted points profile. For this I applied the

Dear all, I would like to know how can I test which are the intervals of my data that have significant less or more counts than the other intervals. Example: Interval [1:200] [200:400] [400:600] [600:800] ... more 900 hundred columns Count 12 28 7 5 Thanks in advance, Best regards João Fadista Ph.d.

If I have a contourplot (in the lattice package) and I want to add straight lines to it, how do I do this? I see that there are llines() and lsegement() functions for lattice plots, but they don't seem to do anything in this case: library(lattice) library(KernSmooth) x=rnorm(10000) y=x+rnorm(x,0,.5) a=bkde2D(cbind(x,y),.7) z=as.vector(a$fhat) grid=expand.grid(x=a$x1,y=a$x2) grid$z=z

Good day everyone, Can anyone suggest an effective method to solve the following problem: I have 2 dataframes D1 and D2 as follows: D1: dates ws wc pwc 2005-10-19:12:00 10.8 80 81 2005-10-20:12:00 12.3 5 15 2005-10-21:15:00 12.3 3 15 2005-10-22:15:00 11.3 13 95 2005-10-23:12:00 12.3 13 2 2005-10-24:15:00 10.3 2 95 2005-10-25:15:00 10.3 2 2 D2:

Dear all, I would like to take out the values from one vector that are equal to the values in another vector. Example: a <- c(1,2,3,4,5,6,7,8,9) b <- c(3,10,20,5,6) b_noRepeats = c(10,20) So I would like to have the vector b without the same values as vector a. Kind regards, João Fadista [[alternative HTML version deleted]]

Dear all, I would like to know how can I compute the length of a string in a dataframe. Example: SEQUENCE ID TGCTCCCATCTCCACGG HR04FS000000645 ACTGAACTCCCATCTCCAAT HR00000595847847 I would like to know how to compute the length of each SEQUENCE. Best regards, João Fadista [[alternative HTML version deleted]]

Hello, I am trying to run "RCMD check" on a package. It performs OK, with the exception of a single warning: * checking package vignettes in 'inst/doc' ... WARNING Package vignette(s) without corresponding PDF: AnnotationFuncsUserguide.Rnw As I understand the problem, the vignette is not built. However, I have no problems in doing so manually. How do I fix this problem? I

Dear List-Members, since 3 weeks I have been heavily working on reproducing the results of an economic paper. The method there uses the numerical solution of an integral within nonlinear least squares. Within the integrand there is also some parameter to estimate. Is that in the end possible to implement in R [Originally it was done in GAUSS]? I'm nearly into giving up. I constucted an

Frede Aakmann T?gersen wrote: > Perhaps > > http://stinet.dtic.mil/cgi-bin/GetTRDoc?AD=ADA266969&Location=U2&doc=GetTRDoc.pdf > > is something that you can use? Thanks a lot - that might help. Rainer > > > > Best regards > > Frede Aakmann T?gersen > Scientist > > > UNIVERSITY OF AARHUS > Faculty of Agricultural Sciences > Dept.

Dear R-help, I have a very large ascii data file, of which I only want to read in selected lines (e.g. on fourth of the lines); determining which lines depends on the lines content. So far, I have found two approaches for doing this in R; 1) Read the file line by line using a repeat-loop and save the result in a temporary file or a variable, and 2) Read the entire file and filter/reshape it using

Dear all, I was trying to see how the function 'confint' is defined. Doing > confint function (object, parm, level = 0.95, ...) UseMethod("confint") <environment: namespace:stats> does not really enlighten me. How can I get to see the implementation (I guess it should be possible according to the general philosophy of the R project)? Thanks in advance S??ren

Dear all, I would like to be able to subset a data.frame in a special way. I will put here an example: Score Name 88 000019_0070 88 000019_0070 87 000019_0070 79 002127_0658 79 002127_0658 77 002127_0658 So, for the above example I would like to have a new data.frame that has only the best "Score" for each

Dear all, I would like to be able to know the intervals of my data that overlap between them. Here it goes a small example: Input: Start End 440 443 380 443 290 468 Desired output: Start End 290 380 380 440 440 468 Best regards, João Fadista [[alternative HTML version deleted]]

Dear all, I would like to know how can I read a text file and create a data frame of only certain parts of the file. For instance, from this text file: =================================================== Matches For Query 0 (108 bases): 000019_0070 =================================================== Score Q_Name S_Name Q_Start Q_End S_Start S_End Direction Bases identity 89 000019_0070

Dear all, In S+, there are functions like create.ole.object call.ole.method release.ole.object for communicating with other programs which work as a COM server (on Windows). Is it possible to do something similar in R (I've studied the 'connections' facilities, but they do not seem to work). ========================================== S?ren H?jsgaard, PhD, Senior Scientist