similar to: genotype analysis

The "genetics" package for handling single-locus genetic data is now available on CRAN in both source and Windows binary formats. The purpose of this package is to make it easy to create and manipulate genetic information, and to facility use of this information in statistical models. The library includes classes and methods for creating, representing, and manipulating genotypes

The "genetics" package for handling single-locus genetic data is now available on CRAN in both source and Windows binary formats. The purpose of this package is to make it easy to create and manipulate genetic information, and to facility use of this information in statistical models. The library includes classes and methods for creating, representing, and manipulating genotypes

HI everyone, I'm plotting a histogram in R and within that histogram i need to demonstrate the percentage of another variable (Percentage of MutStatus) within the bins plotted inthe histogram....I don't know how to do that! Data:Validation_Status Mutation_Status TvarRatio Wildtype None 0.08 Wildtype None 0.08 Wildtype None 0.08 Wildtype None 0.08 Wildtype None 0.080139373 Wildtype None

I evaluated the Bayes factor in the k=2 allele case with a "triangular" prior under the null as in the example in the help file: HWETriangBF2(nvec=c(88,10,2)) [1] 0.4580336 When I swap the n11 entry and n22 entry of nvec, I received totally different Bayes factor: > > HWETriangBF2(nvec=c(2,10,88)) [1] 5.710153 > In my understanding, defining the genotype frequency as

Hi All Please see the Rprofile file which i have modified as follows and after that when I start R then I see that R says to me "TRUE" for all the packages implying that all loaded at once. But when i try to use commands as simple as help("lm"), it doesnt work nor any of the menu "Packages" is not working. Although the regression using lm ( Y ~ X ) is working

Hi! All, To find co-expressed genes from a expression matrix of dimension (9275 X 569), I used rcorr function from library(Hmisc) to calculate pearson correlation coefficient (PCC) and their corresponding p-values. From the correlation matrix (9275 X 9275) and pvalue matrix (9275 X 9275) obtained using rcorr function, I wanted to select those pairs whose PCC's are above 0.8 cut-off and then

Hello everyone, I have a data frame (tt), see below (I only show 2 genes, actually I have a lot): group gene1 gene2 Control 28.9776 9.9355 Control 28.9499 10.0997 Control 29.5468 14.2995 Control 29.5246 13.9561 Test1 29.1864 9.7718 Test1 29.2048 10.0388 Test1 34.9563 11.9509 Test1 34.9464 11.8909 Test2 36.9566 14.5316 Test2 37.1309 14.5188 Test2 36.1017

hi, everyone: i have a question on the reshape function. i have the following dataset : gene tissue patient1 patient2 patient3............. _________________________________________________ gene1 breast 10 20 50 gene2 breast 20 40 60 gene3 breast 100 200 300 which i hope to convert to the following format: gene patientID

Hi, I've looked through the posts but couldn't find a solution to this. I'd be really grateful if someone could help, I'd like to convert a data file of mutual information that is formatted as a matrix:             TF1    TF2    TF3    TF200... Gene1    0.0    0.2    0.2 Gene2    1.4    0.0    2.8 Gene3    0.3    0.6    1.7 Gene6000.... To a list: Gene1    TF1    0.0 Gene1   

Hi, I am doing an analysis to see if these is tissue specific effects on the gene expression data . Our data were collected from 6 different labs (batch effects). lab 1 has tissue type 1 and tissue type 2, lab 2 has tissue 3, 4,5,6. The other labs has one tissue type each. The 'sample' data is as below:

Starting with data from a microarray experiment and I would like to analyse the influence of two factors (age, treatment) on gene expression. Looking through the r-help archives and the web I tried the following: I put my data in a dataframe similar to this one: > example.df <- as.data.frame(matrix(data=runif(32,100,1000), nrow=4, ncol=4)) > example.df <-

HI I am new to R. I have one problem in the predict function of the kernlab. I want to use ksvm and predict with kernelmatrix (S4 method for signature 'kernelMatrix') #executing the following sentences library(kernlab) # identity kernel k <- function(x,y) { n<-length(x) cont<-0 for(i in 1:n){ if(x[i]==y[i]){ cont<-cont+1 } } cont } class(k) <-

I do have a bunch of genes ( nearly ~50000) from the whole genome, which read in genomic ranges A range(gene) can be seem as an observation has three columns chromosome, start and end, like that seqnames start end width strand gene1 chr1 1 5 5 + gene2 chr1 10 15 6 + gene3 chr1 12 17 6 + gene4 chr1 20 25 6 + gene5

Dear all, Once again I need your help ; I fond a way to do what I want but I am sure there is a better way.. maybe you can help me. I have a matrix, for example mat.tot : > mat.tot ID Desc M1 M2 1 1 gene1 0.5 0.2 2 2 gene2 -0.4 -0.1 3 3 gene3 1.0 1.2 4 4 gene1 0.6 0.3 5 5 gene2 -0.3 0.0 and I want to merge line 1 with line 4, and line 2 with line 5 because this is the same gene. I can

Hi all, I have been struggling with this problem for a few days. I have a data table like this: gene rpkm1 diff1 rpkm2 diff2 gene1 23 50 13 120 gene2 111 220 827 1200 gene3 75 998 71 910 And I want to re-format it so that, for each gene, I have a 2x2 contingency table, such as: gene rpkm diff gene1 23 50 gene1 13 120 gene2 111 220 gene2 827

Dear R-devel members, We are building a new package (GeneticsBase) for analysis of genetic data . While doing "R CMD check with R-2.1.1, I am getting the following error: ** building package indices ... Error in "colnames<-"(`*tmp*`, value = c("family", "pid", "father", "mother", : length of 'dimnames' [2] not equal to

hi, folks: i need to transpose the following data: gene tissue patient1 patient2 patient3..... --------------------------------------------- gene1 breast 10 100 1 gene2 breast 20 200 4 gene3 breast 30 50 5 gene4 breast 40 400 9 ................................ to the

Hi, Try this: lines1<- readLines(textConnection("gene1 or1|1234 or3|56 or4|793 gene4 or2|347 gene5 or3|23 or7|123456789")) lines2<-readLines(textConnection(">or1|1234 ATCGGATTCAGG >or2|347 GAACCTATCGGGGGGGGAATTTATATATTTTA >or3|56 ATCGGAGATATAACCAATC >or3|23 AAAATTAACAAGAGAATAGACAAAAAAA >or4|793 ATCTCTCTCCTCTCTCTCTAAAAA >or7|123456789

Hi! All, I am trying to fetch rows from a data frame which matches to first 2 columns of another data frame. Here is the example what I am trying to do: > ptable=read.table(file="All.txt",header=T,sep="\t") > ptable=as.matrix(ptable) > dim(ptable) [1] 9275 6 > head(ptable) Gene1 Gene2 PCC PCC3 PCC23 PCC123 [1,]

Hey guys, can anyone help? i have a sample table: >table <- structure(c(4, 7, 0.2, 3, .1, 7, 222, 3, 10, 5, 11, 8, 8, 10, 7), .Dim = c(5L, 3L), .Dimnames = list(c("gene1", "gene2", "gene3", "gene4", "gene5"), c("codon1", "codon2", "codon3"))) >table codon1 codon2 codon3 gene1 4.0 7