similar to: Finding matches in 2 files

Hello all! I have the following problem with the %in% command: 1) I have a data frame that consists of functions (rows) and genes (columns). The whole has been loaded with the "read.delim" command because of gene-duplications between the different rows. 2) Now, there is another data frame that contains all the genes (only the genes and without duplicates) from all the functions of

Hey guys, can anyone help? i have a sample table: >table <- structure(c(4, 7, 0.2, 3, .1, 7, 222, 3, 10, 5, 11, 8, 8, 10, 7), .Dim = c(5L, 3L), .Dimnames = list(c("gene1", "gene2", "gene3", "gene4", "gene5"), c("codon1", "codon2", "codon3"))) >table codon1 codon2 codon3 gene1 4.0 7

hi, folks: i need to transpose the following data: gene tissue patient1 patient2 patient3..... --------------------------------------------- gene1 breast 10 100 1 gene2 breast 20 200 4 gene3 breast 30 50 5 gene4 breast 40 400 9 ................................ to the

I do have a bunch of genes ( nearly ~50000) from the whole genome, which read in genomic ranges A range(gene) can be seem as an observation has three columns chromosome, start and end, like that seqnames start end width strand gene1 chr1 1 5 5 + gene2 chr1 10 15 6 + gene3 chr1 12 17 6 + gene4 chr1 20 25 6 + gene5

Hey guys, if i do a correspondance analysis, e.g.: table <- structure(c(4, 7, 0.2, 3, .1, 7, 222, 3, 10, 5, 11, 8, 8, 10, 7), .Dim = c(5L, 3L), .Dimnames = list(c("gene1", "gene2", "gene3", "gene4", "gene5"), c("codon1", "codon2", "codon3"))) Library(ca) plot(ca(table)) is there a way that i can see

Hi, I've looked through the posts but couldn't find a solution to this. I'd be really grateful if someone could help, I'd like to convert a data file of mutual information that is formatted as a matrix:             TF1    TF2    TF3    TF200... Gene1    0.0    0.2    0.2 Gene2    1.4    0.0    2.8 Gene3    0.3    0.6    1.7 Gene6000.... To a list: Gene1    TF1    0.0 Gene1   

Hi! All, I am trying to fetch rows from a data frame which matches to first 2 columns of another data frame. Here is the example what I am trying to do: > ptable=read.table(file="All.txt",header=T,sep="\t") > ptable=as.matrix(ptable) > dim(ptable) [1] 9275 6 > head(ptable) Gene1 Gene2 PCC PCC3 PCC23 PCC123 [1,]

hi, everyone: i have a question on the reshape function. i have the following dataset : gene tissue patient1 patient2 patient3............. _________________________________________________ gene1 breast 10 20 50 gene2 breast 20 40 60 gene3 breast 100 200 300 which i hope to convert to the following format: gene patientID

Hello everyone, I have a data frame (tt), see below (I only show 2 genes, actually I have a lot): group gene1 gene2 Control 28.9776 9.9355 Control 28.9499 10.0997 Control 29.5468 14.2995 Control 29.5246 13.9561 Test1 29.1864 9.7718 Test1 29.2048 10.0388 Test1 34.9563 11.9509 Test1 34.9464 11.8909 Test2 36.9566 14.5316 Test2 37.1309 14.5188 Test2 36.1017

Hi, I am doing an analysis to see if these is tissue specific effects on the gene expression data . Our data were collected from 6 different labs (batch effects). lab 1 has tissue type 1 and tissue type 2, lab 2 has tissue 3, 4,5,6. The other labs has one tissue type each. The 'sample' data is as below:

Hi, Try this: lines1<- readLines(textConnection("gene1 or1|1234 or3|56 or4|793 gene4 or2|347 gene5 or3|23 or7|123456789")) lines2<-readLines(textConnection(">or1|1234 ATCGGATTCAGG >or2|347 GAACCTATCGGGGGGGGAATTTATATATTTTA >or3|56 ATCGGAGATATAACCAATC >or3|23 AAAATTAACAAGAGAATAGACAAAAAAA >or4|793 ATCTCTCTCCTCTCTCTCTAAAAA >or7|123456789

Hi. I have two vectors of gene expression for each of several days. I want to plot both vectors on the same plot for a visual representation of up versus down regulation. I've tried using add=T but that doesn't work. eg >plot(Day, gene1) >plot(Day, gene2, add=T) Any help would be appreciated. Iain

Hi all, I have been struggling with this problem for a few days. I have a data table like this: gene rpkm1 diff1 rpkm2 diff2 gene1 23 50 13 120 gene2 111 220 827 1200 gene3 75 998 71 910 And I want to re-format it so that, for each gene, I have a 2x2 contingency table, such as: gene rpkm diff gene1 23 50 gene1 13 120 gene2 111 220 gene2 827

Dear Sir/Madam, I found your email address and your correspondence with R-users. I hope you could help me with this question about the function "ur.ers" in the package of "urca". It is an improved unit root test (Elliott et al. 1996 Econometrica). Do you know how to extract the value of the test statistic from the output? The only thing I can get is the print-out of all

Hey guys, Can anyone help? I did a correspondance analysis and made a plot. I also have a specific list of nodes that i want to find in my plot and want to either color the nodes that appear in my list differently, or put some kind of border around that group of nodes... Would anyone know how to do this? Also, would this post be more relevant here or in the bioconductor forum? -- View this

Hi All, I have a microarray dataset as follows:                           expt1 expt2 expt3  expt4 expt 5  gene1                val      val     val      val     val gene2                val      val     val      val    val . . .. gene15000       val       val     val      val     val The result is from the same organism in four different experiments.  Also, there are 4 replicates of each

Greetings all, I have two sets of data that I would like to investigate. The first is gene/genome related data given different 'cell-states'. The second set of data is relates the genes to a biological pathway. /(I think in pictures so here goes.)/ *dataframe1* gene, cell-state1, cell-state2 gene1, x1, y1 gene2, x2, y2 gene.x, ..., ... *dataframe2* pathway1, gene-x1, gene-x2, ...

I am using 'igraph' package to make some graphs of 'gene-gene interaction'. I can get a data.frame which has three columns. gene1 gene2 pvalue AGT MLR 1.2e-04 MLR 11BHSD1 1.71e-05 IFG2 11BHSD2 2.2e-07 . . . . . . . . . AGTR1 NPPA

Hi, this might be basic but can't get it to work and it is hampering my R usage: #the loop is checking variance of rows, and cutting out rows with var>numVec[i] #I define outMat as object names I want to output to (does this make sense? how else #can I define sequential numbered output?) #numVec is numbers I use in the loop head(Counts) AN1 AN2 AN3 AN4 var GENE1

Hi R users, I generated a square correlation matrix for the dat dataframe below; dat<-data.frame(g1=c(1,0,0,1,1,1,0,0,0), g2=c(0,1,0,1,0,1,1,0,0), g3=c(1,1,0,0,0,1,0,0,0), g4=c(0,1,0,1,1,1,1,1,0)) library("Hmisc") dat.rcorr = rcorr(as.matrix(dat)) dat.r <-round(dat.rcorr$r,2) however, I want to modify this correlation calculation;