similar to: remove columns having a partial match name

Dear all, I would like to know how can I create a binned column in a data.frame. The output that I would like is something like this: Start Binned_Start 1 0-5 2 0-5 6 5-10 8 5-10 13 10-15 ... Best regards João Fadista Ph.d. student UNIVERSITY OF AARHUS Faculty of Agricultural Sciences Dept. of Genetics and Biotechnology Blichers

Dear all, Can I do a permutation test if the number of individuals in one group is much bigger than in the other group? I searched the literature but I didin´t find any assumption that refers to this subject for permutation tests. Best regards João Fadista Ph.d. student UNIVERSITY OF AARHUS Faculty of Agricultural Sciences Dept. of Genetics and Biotechnology Blichers Allé 20, P.O.

Dear all, I would like to know how can I concatenate 2 data.frames into a single one. Both data frames have the same number of columns and the same class type in each correspondent column. So what I want is to have a new data.frame where I have first the values from one data.frame and then the values from a second data.frame would came after in this new data.frame. Thanks in advance. Med

Dear all, I would like to know if I can compare by a significance test 2 models with different kind of parameters. Perhaps I am wrong but I think that we can only compare 2 models if one is a sub model of the other. Med venlig hilsen / Regards João Fadista Ph.d. studerende / Ph.d. student AARHUS UNIVERSITET / UNIVERSITY OF AARHUS Det Jordbrugsvidenskabelige Fakultet / Faculty of

Dear all, I would like to know if there is any R package that uses a sliding window approach to assess statistical significance out of my data. My data is composed of DNA sequences (of variable length) that are mapped to a genome with a determined score of alignment. So, I want to see if I can find more tags in a given region of the genome as opposed to finding them by chance. In this sliding

Dear all, I have the positions of N points spread through some sequence of length L (L>N), and I would like to know how can do the following: 1- Permute the positions of the N points along the whole sequence. Assuming a uniform distribution I did: position1 <- runif(N, 1, L) 2- Apply a kernel convolution method to the resulting permuted points profile. For this I applied the

Dear all, I would like to know how can I test which are the intervals of my data that have significant less or more counts than the other intervals. Example: Interval [1:200] [200:400] [400:600] [600:800] ... more 900 hundred columns Count 12 28 7 5 Thanks in advance, Best regards João Fadista Ph.d.

Hello, I am trying to run "RCMD check" on a package. It performs OK, with the exception of a single warning: * checking package vignettes in 'inst/doc' ... WARNING Package vignette(s) without corresponding PDF: AnnotationFuncsUserguide.Rnw As I understand the problem, the vignette is not built. However, I have no problems in doing so manually. How do I fix this problem? I

Frede Aakmann T?gersen wrote: > Perhaps > > http://stinet.dtic.mil/cgi-bin/GetTRDoc?AD=ADA266969&Location=U2&doc=GetTRDoc.pdf > > is something that you can use? Thanks a lot - that might help. Rainer > > > > Best regards > > Frede Aakmann T?gersen > Scientist > > > UNIVERSITY OF AARHUS > Faculty of Agricultural Sciences > Dept.

Dear R-help, I have a very large ascii data file, of which I only want to read in selected lines (e.g. on fourth of the lines); determining which lines depends on the lines content. So far, I have found two approaches for doing this in R; 1) Read the file line by line using a repeat-loop and save the result in a temporary file or a variable, and 2) Read the entire file and filter/reshape it using

Dear all, I would like to take out the values from one vector that are equal to the values in another vector. Example: a <- c(1,2,3,4,5,6,7,8,9) b <- c(3,10,20,5,6) b_noRepeats = c(10,20) So I would like to have the vector b without the same values as vector a. Kind regards, João Fadista [[alternative HTML version deleted]]

Dear all, I would like to know how can I compute the length of a string in a dataframe. Example: SEQUENCE ID TGCTCCCATCTCCACGG HR04FS000000645 ACTGAACTCCCATCTCCAAT HR00000595847847 I would like to know how to compute the length of each SEQUENCE. Best regards, João Fadista [[alternative HTML version deleted]]

If I have a contourplot (in the lattice package) and I want to add straight lines to it, how do I do this? I see that there are llines() and lsegement() functions for lattice plots, but they don't seem to do anything in this case: library(lattice) library(KernSmooth) x=rnorm(10000) y=x+rnorm(x,0,.5) a=bkde2D(cbind(x,y),.7) z=as.vector(a$fhat) grid=expand.grid(x=a$x1,y=a$x2) grid$z=z

Dear all, I was trying to see how the function 'confint' is defined. Doing > confint function (object, parm, level = 0.95, ...) UseMethod("confint") <environment: namespace:stats> does not really enlighten me. How can I get to see the implementation (I guess it should be possible according to the general philosophy of the R project)? Thanks in advance S??ren

Good day everyone, Can anyone suggest an effective method to solve the following problem: I have 2 dataframes D1 and D2 as follows: D1: dates ws wc pwc 2005-10-19:12:00 10.8 80 81 2005-10-20:12:00 12.3 5 15 2005-10-21:15:00 12.3 3 15 2005-10-22:15:00 11.3 13 95 2005-10-23:12:00 12.3 13 2 2005-10-24:15:00 10.3 2 95 2005-10-25:15:00 10.3 2 2 D2:

Dear R-Help, I have an array 1260x1260, upper triangle consisting of numbers between 0 and 100, and lower triangle all NA. I can extract the index of those values say above 99 using the following code: which(myArray>=99 , ind.arr=T) which returns: row col 5475 252 253 45423 764 765 46902 777 778 34146 611 962 50681 1220 1221 Now I would like to if poss print the actual value

Hello everybody, I'm trying to predict a linear regression model but it does not work. My Model: y = Worktime + Vacation + Illnes + Bankholidays My modelmatrix is of dimension 28x4 Then I want to make use of the function predict because there confidence.intervals are include. My idea was: mod <- lm(y~Worktime+Vacation+Illnes+Bankholidays) newdate=data.frame(x=c(324,123,0.9,0.1))

Hello list I have a theoretical differential equation model (two coupled differential equations) describing the acidification of dairy cultures in milk: dX/dt = f(H, param)*X dH/dt = g(param)*dX/dt pH = -log10(H) I also have actual data of the same. I would like to estimate the parameters of the theoretical model from real data, but don't know how to go about it in R (I'm fairly new

I have a vector whose length is nearly 70 thousand. I need randomize it for 1000 times . for randomizing , I mean ,the elements of the vector remain intact while their order in the vector get changed randomly. I have written a function which seems to be able to solve short vectors , but waste a lot of time when dealing with the the long vector mentioned above. -- View this message in context:

R-help, I'm trying to work out the density function by doing: > df(5.22245, 3, 22) [1] 0.005896862 > df(15.20675, 6, 4) [1] 0.001223825 In excell the result is : 0.0071060464 <*> FDIST(5.22245,3,22) 0.0100001406 <--> FDIST(15.20675,6,4) >From my point of view the differences in the second case are substantial. Can anyone give me a hint on this? Thanks in