similar to: Model comparison

Dear all, I would like to know how can I concatenate 2 data.frames into a single one. Both data frames have the same number of columns and the same class type in each correspondent column. So what I want is to have a new data.frame where I have first the values from one data.frame and then the values from a second data.frame would came after in this new data.frame. Thanks in advance. Med

Dear all, Can I do a permutation test if the number of individuals in one group is much bigger than in the other group? I searched the literature but I didin´t find any assumption that refers to this subject for permutation tests. Best regards João Fadista Ph.d. student UNIVERSITY OF AARHUS Faculty of Agricultural Sciences Dept. of Genetics and Biotechnology Blichers Allé 20, P.O.

Dear all, I would like to know how can I retrieve a data.frame without the columns that have a partial match name. Let´s say that I have a data.frame with 200 columns and 100 of them have the name "StartX", with X being the unique part for each column name. I want to delete all columns that have the name starting with "Start". I´ve tried to do this but it doesn´t work: >

Dear all, I would like to know how can I create a binned column in a data.frame. The output that I would like is something like this: Start Binned_Start 1 0-5 2 0-5 6 5-10 8 5-10 13 10-15 ... Best regards João Fadista Ph.d. student UNIVERSITY OF AARHUS Faculty of Agricultural Sciences Dept. of Genetics and Biotechnology Blichers

Dear all, I would like to know if there is any R package that uses a sliding window approach to assess statistical significance out of my data. My data is composed of DNA sequences (of variable length) that are mapped to a genome with a determined score of alignment. So, I want to see if I can find more tags in a given region of the genome as opposed to finding them by chance. In this sliding

Dear all, I have the positions of N points spread through some sequence of length L (L>N), and I would like to know how can do the following: 1- Permute the positions of the N points along the whole sequence. Assuming a uniform distribution I did: position1 <- runif(N, 1, L) 2- Apply a kernel convolution method to the resulting permuted points profile. For this I applied the

Dear all, I would like to know how can I test which are the intervals of my data that have significant less or more counts than the other intervals. Example: Interval [1:200] [200:400] [400:600] [600:800] ... more 900 hundred columns Count 12 28 7 5 Thanks in advance, Best regards João Fadista Ph.d.

Dear all, I was trying to see how the function 'confint' is defined. Doing > confint function (object, parm, level = 0.95, ...) UseMethod("confint") <environment: namespace:stats> does not really enlighten me. How can I get to see the implementation (I guess it should be possible according to the general philosophy of the R project)? Thanks in advance S??ren

Dear all, In S+, there are functions like create.ole.object call.ole.method release.ole.object for communicating with other programs which work as a COM server (on Windows). Is it possible to do something similar in R (I've studied the 'connections' facilities, but they do not seem to work). ========================================== S?ren H?jsgaard, PhD, Senior Scientist

Dear all, the application of the function rstandard() in the base package to a glm object does not produce residuals standardized to have variance one: the reason is that the deviance residuals are divided by the dispersion estimate and not by the square root of the estimate for the dispersion. Should the function not be changed to produce residuals with a variance about 1? R 1.8.1 on

I am trying to build a package binary, and get the message below. Can anyone point me to a solution to that problem. Thanks in advance S?ren .... installing data files installing man source files installing indices Error in load(zfile, envir = envir) : input has been corrupted, with LF replaced by CR Execution halted make[2]: *** [indices] Error 1 make[1]: *** [all] Error 2

Well, one way to do it is xyplot(y~time|id, data=dat,type='l', panel=function(x,y,subscripts,...){ panel.xyplot(x,y,subscripts,...) panel.abline(v=dat[subscripts,"cm1"]) panel.abline(v=dat[subscripts,"cm2"]) } ) Since I don't know what the dataframe 'mergeData' is I have used 'dat'. Best regards Frede Aakmann

Dear all, I am using the R package SNPRelate but I found an error when I run the following command. Do you know what might be the problem? Thanks in advance. > vcf.fn <- system.file("extdata", "sequence.vcf", package="SNPRelate") > snpgdsVCF2GDS(vcf.fn, "test.gds") Start snpgdsVCF2GDS ... Open

Dear all, I would like to take out the values from one vector that are equal to the values in another vector. Example: a <- c(1,2,3,4,5,6,7,8,9) b <- c(3,10,20,5,6) b_noRepeats = c(10,20) So I would like to have the vector b without the same values as vector a. Kind regards, João Fadista [[alternative HTML version deleted]]

Hello R-Users I am struggling with this line plot, it might be simple but I am missing something here. First of all I want to make multiple line plots across seasons (DJF,MAM,JJA,SON) for 12 variables (here, called nodes) and fill them with the node. So that season=x-axis, node=line col and freq=y-axis. My plot currently links all DJFs, MAMs, JJAs and SONs, however I will like them to be

Dear all, I would like to know how can I compute the length of a string in a dataframe. Example: SEQUENCE ID TGCTCCCATCTCCACGG HR04FS000000645 ACTGAACTCCCATCTCCAAT HR00000595847847 I would like to know how to compute the length of each SEQUENCE. Best regards, João Fadista [[alternative HTML version deleted]]

Dear all, I would like to be able to subset a data.frame in a special way. I will put here an example: Score Name 88 000019_0070 88 000019_0070 87 000019_0070 79 002127_0658 79 002127_0658 77 002127_0658 So, for the above example I would like to have a new data.frame that has only the best "Score" for each

Dear all, I would like to be able to know the intervals of my data that overlap between them. Here it goes a small example: Input: Start End 440 443 380 443 290 468 Desired output: Start End 290 380 380 440 440 468 Best regards, João Fadista [[alternative HTML version deleted]]

Dear all, I would like to know how can I read a text file and create a data frame of only certain parts of the file. For instance, from this text file: =================================================== Matches For Query 0 (108 bases): 000019_0070 =================================================== Score Q_Name S_Name Q_Start Q_End S_Start S_End Direction Bases identity 89 000019_0070

Dear all, When we perform a Wilcoxon rank sum test (on two samples with different sizes) we get a test statistic. My question is, as the value of test statistic increases the difference between the distributions of the two samples also increase, right? Thanks in advance, João Fadista [[alternative HTML version deleted]]