similar to: Boost Protein Expression by Codon Optimization

Dear Colleague, Happy New Year! As we know, codon preference among different species could be dramatically different. To enhance the expression level of a foreign protein in a particular expression system (E.coli, Yeast, Insect, or Mammalian cell), it is very important to adjust the codon frequency of the foreign protein to match that of the host expression system. One classic example is GFP

Hey guys, I have what i think is a really simple problem :( I installed the seqinr library. I want to do an RSCU analysis. But i can't get it to work in even the simplest case. for example, if i have a string read in: > newdata5 $testseq [1] "agtgagatgatagatagatagatagatagatagatagaccccccagata" and then i perform an RSCU analysis on it... >

 Sir,  I am a student in biostat and bioinformatics.  I am interested to use R for my research work related to codon usage analysis.This software was used in a publication entitled " Online synonymous codon usage analyses with the ade4 and seqinR packages" and a weblink  http://pbil.univ-lyon1.fr/datasets/charif04/ was given for readers to use the program. Now  I would like to use the

Hi I'm looking for a package to perform quality control, normalization and analysis of high throughput cell-base chemical screens. I know that the cellHTS2 package provides this for siRNA screens. Does anybody know if something like what I'm looking for exists? Thank you! Gabriele Zoppoli, MD Ph.D. Fellow, Experimental and Clinical Oncology and Hematology, University of Genova,

Hello, Im trying to create a heatmap with a dataset (38 x 15037) but get the error below: Error: protect(): protection stack overflow Execution halted or Error: C stack usage is too close to the limit Execution halted I tried to increase the stack size by changing: extern uintptr_t R_CStackLimit but my systems manager said that R by default uses all the memory available to it from the

The right candidate will work closely with neuroscientists seeking to discover new medicines to treat Alzheimer?s disease, bipolar illness, schizophrenia and autism. He/she will be involved in the design and analysis of preclinical experiments covering all aspects of drug discovery from disease target identification through animal model development and demonstration of proof of concept. The

Hi, I am writing to seek some guidance regarding using Lasso regression with the R package LARS. I have introductory statistics background but I am trying to learn more. Right now I am trying to duplicate the results in a paper for shRNA prediction "An accurate and interpretable model for siRNA efficacy prediction, Jean-Philippe Vert et. al, Bioinformatics" for a Bioinformatics project

What I am trying to do is use GUI function, traitr, and to call for a pdb file and save it and then display it. I want to call for it by taking it from the user and then displaying it on the screen. I am having problems with that. The line pdb <- read.pdb(""ProteinCode) where proteincode should be the name of the protein, for example 1ly2, but it always ends up being protein. My

Hello!!! I have a question about clustering. I'll present my problem first. I have a simulation of a protein trayectory (a file with a time series of protein 3D-coordinates), from it I can calculate the Root Mean Square desviation (RMSD) beetween any pair of structures in the trayectory, which is a rough idea of 3D similarity beetween them. If for every conformation (trayectory frame) I

Dear R users, I would like to align two protein sequences using BLAST (bl2seq). The question is whether this programm have been implemented in R. Thank you for your help, Alla.

Dear All, I would like to generate random protein sequences using a HMM model. Has anybody done that before, or would you have any idea which package is likely to be best for that? The important facts are that the HMM will be fitted on ~3 million sequential observations, with 20 different states (one for each amino acid). I guess that 2-5 hidden states should be enough, and an order of 3 would

Dear All, I need to fetch GO ontologies for Homo sapiens with their mappings to corresponding Uniprot identifiers. I would be using this information to compare result from a clustering algorithm with existing protein complexes. This would be a test to check how the clustering algorithm accurately captures GO terms with respect to the known protein complexes. Can anyone suggest a simple workflow

Hi Dave, ----- Mail original ----- > Changes since v1: [...] > diff --git a/drm/nouveau/nouveau_vga.c b/drm/nouveau/nouveau_vga.c > index 9a6328f..7b13804 100644 > --- a/drm/nouveau/nouveau_vga.c > +++ b/drm/nouveau/nouveau_vga.c > @@ -36,7 +36,7 @@ nouveau_switcheroo_set_state(struct pci_dev *pdev, > { > struct drm_device *dev = pci_get_drvdata(pdev); > > - if

HI, Dear R community, My original file has 1932 lines, but when I read into R, it changed to 1068 lines, how comes? cdu@nuuk:~/operon$ wc -l id_name_gh5.txt 1932 id_name_gh5.txt > gene_name<-read.table("/home/cdu/operon/id_name_gh5.txt", sep="\t", skip=0, header=F, fill=T) > dim(gene_name) [1] 1068 3 -- Sincerely, Changbin -- Changbin Du DOE Joint Genome

Hi all, Given a matrix: > mat [,1] [,2] [,3] [1,] 0 0 0 [2,] 3 3 3 [3,] 1 1 1 [4,] 2 1 1 How can I convert it to a list of strings: > desired_output [1] "aaa" "ttt" "ccc" "gcc" In principle: 1. Number of Column in matrix = length of string (= 3) 2. Number of Row in matrix = length of vector ( = 4). 3.

Hi, I tried to configure the new idmap interface. Currently without much success. I have two samba domains, trusting each other. Each PDC using it's own LDAP server. I tried idmap domains = DOM1, DOM2 idmap config DOM1:default = yes idmap config DOM1:backend = ldap idmap config DOM1:ldap_base_dn = ou=Idmap,dc=dom1,dc=mydomain,dc=de idmap config

Dear R-helpers: thank your for your attention. i am a newer to R and i am doing some protein category classification based on the amino acid sequence.while i have some questions urgently. 1. any packages for analysis amino acid sequence 2. given two sequences "AAA" and "BBB",how can i combine them into "AAABBB" 3. based on "AAABBB",how can i get some

Hi all, I have been investigating linker scripts and the functionality needed to support them in lld. I have attached my findings about the usage of ldscripts. My findings have been collected from: - Reading all the GNU ld manual sections about linker scripts. - Looking at the GNU ld and gold source code. - Digging through a couple embedded programming tutorials. - Reading through all of the

Full_Name: Emily Green Version: 2.8.0 GUI 1.26 OS: MacBrook Pro with 2.5 GHz processor, using Mac OS X 10.5.5 Submission from: (NULL) (144.32.69.137) I am wanting to correct for phylogeny using a phylogenetic tree of 296 birds species, which I have constructed myself. The file format is correct and I have checked its display in Mesquite, which exported the nexus file (I've pasted the text of

Greetings, I'm trying to track down and eliminate the sources of excessive disk activity in an idle system that is resulting in premature hard disk failure. Access time updates to inodes turned out to be the worst culprit, triggering writes every 35 seconds or so. Mounting filesystems with the noatime option fixed that problem. But not too far behind inode updates is the frequent