Displaying 20 results from an estimated 10000 matches similar to: "Problem with ties in rank()"
2002 May 07
1
More on ties with rank()
I am grateful to Prof. Ripley for his explanation. Indeed, rounding explains
it all.
I take the difference between two vectors and call it "z"
method.a <- c(6.3, 6.3, 3.5, 5.1, 5.5, 7.7, 6.3, 2.8, 3.4, 5.7, 5.6, 6.2,
6.6,
                       7.7, 7.4, 5.6, 6.3, 8.4, 5.6, 4.8, 4.3, 4.2, 3.3,
3.8, 5.7, 4.1)
method.b <- c(5.2, 6.6, 2.3, 4.4, 4.1, 6.4, 5.4, 2.3, 3.2, 5.2, 4.9,
2006 Mar 02
1
Curious subsetting behavior
I have a simple vector, called tmp that I want to subset based on another
vector called vec.  Everything works as expected except for below where the
subsetting returns something other than the original data.  Any ideas?
> vec <- c(1,2,3,4,5,59,60,27,32,21)
> tmp
 [1]  1.0  1.1  2.0  2.1  2.2  3.0  3.1  4.0  5.0  5.1  6.0  7.0  8.0  8.1
9.0
[16]  9.1  9.2 10.0 10.1 11.0 12.0 13.0 14.0
2009 Jan 05
1
How to extract range of colums in a data frame
Dear all,
I have the following data frame:
> dat
   V1                                 V2   V3 V4    V5   V6   V7   V8   V9
1   1 AAAACACCCACCCCCCCCCCCCCCCCCCCCCCCC  9.0 18 12.00 18.0 15.0 12.0  6.0
2   1 ACGATACGGCGACCACCGAGATCTACACTCTTCC 18.0  8 12.00 18.0 15.0 12.0 18.0
3   1 ACTACTGCTCCCCCCCCACTCCCCCCCCCCCCCC 15.0  8 12.00 12.0 18.0 12.0 12.0
4   1 ACTTATACGGCGACCACCGAGATCTACACTCTTT 15.0 
2013 Jan 03
2
Sas by function in R
Hello,
It's an alternative to use SAS by function in R?
I want to plot d histograms by plot.from example bellow:
Thank you!
   plot     d
1      1  16.3
2      1  25.0
3      1  57.8
4      1  17.0
5      2  10.8
13     2  96.4
17     3  76.0
18     3  32.0
19     3  11.0
20     3  11.0
24     3 106.0
25     3  12.5
21     4  19.3
22     4  12.0
26     4  15.0
27     5  99.3
32     7  11.0
36 
2010 Apr 16
2
managing data and removing lines
Hi,
I am very new to R and I've been trying to work through the R book to gain a
better idea of the code (which is also completely new to me).
Initially I imputed my data from a text file and that seemed to work ok, but
I'm trying to examine linear relationships between gdist and gair, gdist and
gsub, m6dist and m6air, etc.
This didn't work and I think it might have something to do
2008 Nov 21
1
question about shapiro.test()
Hi all!
I tried to perform Shapiro-Wilk test for my sample of 243 values.
> Us
  [1] -10.4 -13.1 -12.2  38.1 -18.8 -13.3 -11.7  29.3  49.7   6.8  12.7  16.3
 [13]   5.8  -0.7 -29.4   4.1  38.8  -1.4   8.8  15.6  32.9  -5.3  19.1  35.8
 [25]   4.0  -1.5   0.6  -4.2 -10.0  -4.0   1.1  48.9 -21.0  -5.3   5.8 -10.8
 [37]  21.9   8.2  -3.2  -3.9  -2.3  12.6  -4.7  -8.0  11.8  27.4  -9.5 -20.8
 [49] 
2006 Jan 18
3
linear contrasts with anova
I have some doubts about the validity of my procedure to estimeate linear contrasts ina a factorial design.
For sake of semplicity, let's imagine a one way ANOVA with three levels. I am interested to test the significance of the difference between the first and third level (called here contrast C1) and between the first and the seconda level (called here contrast C2). I used the following
2000 Feb 23
1
Version 0.90.1 bug report on matrix indexing
Hi ,
R Version 0.90.1 on Solaris2.5 and Suse Linux 6.[1,3] crashes some time
after a matrix row or column has been addressed via an incorrect
row/colname:
R : Copyright 1999, The R Development Core Team
Version 0.90.1  (December 15, 1999)
R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type    "?license" or
2011 Jul 17
1
creating a matrix of ranked column data
I have a data frame (gom) or a matrix of trace metal data and some other
observations from water column samples taken at sea (e.g., 19 samples
(rows), 19 variables)
I can calc. the rank individually from each column of the attached object.
How can I create a matrix that contains the ranked data for each variable
(either 1-19, ties=avg)?
For example:
>gom<-read.csv ("gomdata.csv")
2008 Dec 05
2
adding rows as arithmatic calculation on original rows
Dear R users,
Suppose I have the following data.frame:
myID myType myNum1 myNum2 myNum3
a       Single       10          11           12
b       Single       15          25           35
c       Double      22          33           44
d       Double        4           6             8
and I want to have new records:
myID myType myNum1 myNum2 myNum3
e      Single       12.5       18          
2013 Feb 15
3
datos climáticos cambio de formato
Hola!!
tengo un data.frame donde cada fila corresponde a un año y cada columna a
un mes (De enero a diciembre)
> head(valT)
            V2   V3   V4     V5   V6  V7  V8  V9    V10    V11  V12  V13
1941 18.0 16.3 15.2   10.1  8.1 8.3 8.8 9.2    7.9   12.2 11.9 14.6
1942 17.2 15.9 13.6   11.6  8.7 6.2 6.4 7.2    9.7   12.0 14.1 16.7
1943 17.6 17.3 13.5   12.5 10.5 7.0 8.2 7.9 -999.9 -999.9
2008 Sep 09
1
Substitute Values in a Matrix?
Hi,
I'm searching for a function to subistute Values in a Matrix to new Values.
For example: 
old value  new value
1.1             6
1.2             7
.                .
.                .
.                .
1.9             14
2.0             15
and
2.1             15.5
2.2             16
.                .
.                .
2.9             19.5
3.0             20
There is a difference
2007 Apr 11
0
raidz2 another resilver problem
Hello zfs-discuss,
One of a disk started to behave strangely.
Apr 11 16:07:42 thumper-9.srv sata: [ID 801593 kern.notice] NOTICE: /pci at 1,0/pci1022,7458 at 3/pci11ab,11ab at 1:
Apr 11 16:07:42 thumper-9.srv  port 6: device reset
Apr 11 16:07:42 thumper-9.srv scsi: [ID 107833 kern.warning] WARNING: /pci at 1,0/pci1022,7458 at 3/pci11ab,11ab at 1/disk at 6,0 (sd27):
Apr 11 16:07:42 thumper-9.srv
2001 Sep 05
3
Bug in ftable?? (Was: Two-way tables of data, etc)
Further to the discussion between Murray Jorgensen and Brian Ripley,
it seems to me better to choose tabulations that will not come and bite
you. Suppose your data are sligtly irregular, e.g. (for the sake of
the argument):
data( warpbreaks )
warpbreaks$variant <- rep( 1:5, len=54 )
attach( warpbreaks )
tb <- table( wool, tension, variant )
tb
# in this case you would like to see:
tp
2001 Sep 05
3
Bug in ftable?? (Was: Two-way tables of data, etc)
Further to the discussion between Murray Jorgensen and Brian Ripley,
it seems to me better to choose tabulations that will not come and bite
you. Suppose your data are sligtly irregular, e.g. (for the sake of
the argument):
data( warpbreaks )
warpbreaks$variant <- rep( 1:5, len=54 )
attach( warpbreaks )
tb <- table( wool, tension, variant )
tb
# in this case you would like to see:
tp
2009 Apr 22
2
function output with for loop and if statement
Hello all, turns out i'm having a bad R week.  I am at my wits end with a function that I am trying to write.  When I run the lines of code outside of a function, I get the desired output.  When I wrap the lines of code into a function it doesn't work as expected.  Not sure what is going on here.  I suspected that the syntax of the if statement with the for loop was the culprit, but when I
2007 Apr 20
2
sorting data in R
hello,
I'd  like  know how to sort a data frame in R for example how I should do to sort by Catholic with swiss data frame like below
thanks
             Fertility Agriculture Examination Education Catholic Infant.Mortality
Courtelary        80.2        17.0          15        12     9.96             22.2
Delemont          83.1        45.1           6         9    84.84             22.2
2008 Oct 15
1
combining same-day lab measurements with 'apply'
Another request for help implementing the 'apply' functions to avoid a
loop structure...
I am working with a data set that includes lab measurements taken at
different dates for the subjects, with some subjects having more
results than others.  I would like to average lab results for each
subject that were taken on the same day.  I can do this using a for
loop, but would like to know how
2006 Apr 07
1
Aggregating an its series
I'm using a very long irregular time-series of air temperature and 
relative humidity of this kind (this is an extract only)
its.format("%
Y%d%m %X)
> base
                                 T  H
20020601 
12.00.00 27.1 47
20020601 15.00.00 29.1 39
20020601 18.00.00 27.4 39
20020601 21.00.00 24.0 40
20020602 0.00.00  22.0 73
20020602 3.00.00  
19.2 49
20020602 6.00.00  19.5 74
20020602
2013 Jun 12
1
Question on Simple Repeated Loops
Dear R-User,
Appreciate any helps. It looks simple, but I don't have a clue.
Given that I have a dataframe of tree population with three variables:
sp=species ,
d0=initial_size
grow=growth increment from initial size per year
How can I calculate the future growth increment of each tree  for the next 3 years.
The following Rscript was written,
#----------
a0 <-