similar to: Excel Add-in

Bonjour, J'ai t?l?charg? SciViews Insider que je trouve tr?s convivial. Par contre, je n'arrive pas ? comprendre comment enregistrer un script R en type de fichier R justement. Mes programmes fonctionnent tr?s bien, mais SciViews me propose uniquement de les enregistrer au format txt sous un type de fichier "bloc notes". Comment les enregistrer avec l'extension .R comme le

Hi, I'm trying to combine a VBA macro and a R package. I've installed the R-(D)COM and the R-excel interface by Neuwirth. They seem to work both. However I would like to display the r-generated data in an Excel sheet as an array but I don't manage. Here is an example of my source: Sub doR() Call RInterface.StartRServer Call RInterface.RRun("library(mdnn)") Call

Hello, I have to create help files on R. I used the "package.skeleton" function which allowed to me to create a personal package with my list of functions. But I don't understand what I have to install to use these. That needs the tools to build packages from source to be installed. I will need the files in the R binary Windows distribution for installing source packages to be

I'm currently having a problem with the new released Samba 2.2.5: I cannot print anymore on my shared printer. What is strange is that It worked fine with samba 2.2.4, but now I got an access denied whenever I try to access the printer... /var/spool/lpd/samba is chmod 777 and the username is in the group lp Here is part of my smb.conf: [global] workgroup = HOME netbios name =

Hi, I have a program written in R which is good on the version 1.2, but for the fallowing versions of R, an error always is at the same place. That is at the level of the fallowing line: Sur<- getInitial(res2[m:M,2]~SSasymp(res2[m:M,1],Asymp,resp0,lrc),data=res2) Error in eval(expr,envir,enclos):numeric envir arg not of length one I don't know at all this langage for the instant.

Ok, I solved the problem by myself. The problem was that the users with wich I tried to connect to the printer where defined as admin users, and I declared root as an invalid user in the samba configuration, so it always give me an access denied because it tried to connect as root. Anyway thanks for the time you waste trying to help me ;-) ----Message r?exp?di?---- >Date: Thu, 27 Jun 2002

Bonjour, J'etudie une population de chevaux en captivite. Je souhaite identifier le ou les facteurs qui influencent la fecondite des femelles (=nombre de poulain= 0 ou 1) depuis 1995 jusqu'a 2003. Les variables explicatives sont donc disponibles pour les femelles par annee : fem1_annee1 fem2_annee1 fem3_annee1 fem1_annee2 fem2_annee2 fem3_annee2 fem4_annee2 etc. Le nombre de femelles

hello, 1)i have samba 2.2.2 running on HPUX11.0 64 bits and i have the folowing message in my user log: [2001/11/19 20:29:04, 0] smbd/nttrans.c:(1762) call_nt_transact_ioctl: Currently not implemented. [2001/11/19 20:29:04, 0] lib/util_sec.c:(94) Failed to set gid privileges to (-1,-2) now set to (0,0) uid= (0,0) [2001/11/19 20:29:04, 0] lib/util.c:(1055) PANIC: failed to set gid 2) when i

Hi, I am out of town and will get back to you on the 13th of July. Leo >>> "r-help at stat.math.ethz.ch" 06/27/03 00:32 >>> Send R-help mailing list submissions to r-help at stat.math.ethz.ch To subscribe or unsubscribe via the World Wide Web, visit https://www.stat.math.ethz.ch/mailman/listinfo/r-help or, via email, send a message with subject or body

Hello, I am trying to import data from an SQLite database to R. Unfortunately, I seem to get wrong data when I try to import very large numbers. For example: I look at the database via SQLiteStudio(v.1.1.3) and I see the following values: OrderID Day TimeToclose 1 2009-11-25 29467907000 2 2009-11-25 29467907000 3 2009-11-25 29467907000 Now I run this R Code: >

(Server :Mandrake 7, Samba 2.0.6) (Client : PC Win95 and Win 98) Samba's work fine since one year but yesterday We had a big problem in my college Lots of PC's client can't connect (invalid password). In the samba's log we read : > [2000/05/19 12:15:21, 1] smbd/service.c:close_cnum(568) > renoir (192.168.84.189) closed connection to service valancee > [2000/05/19

Hi Is there a possibility to run diskless PCs under Windows 98 or Windows ME with all the files located on a samba server ? TIA Zack ----- La messagerie itin?rante sans abonnement NetCourrier ----- Web : www.netcourrier.com - Minitel : 3615 NETCOURRIER T?l?phone : 08 36 69 00 21

Just dived into linux recently and spent a whole day on trying geing chinese programs working properly in wine. The situation is that some chinese programs (like eMule) display Chinese character very nicely while some others can not. Here is the screenshot: [Image: http://www.jg300.com/www/Screenshot-dzh.png ] What I have done: 1. apt-get ttf-wqy-microhei 2. Copy the downloaded font to

Hey guys, I have what i think is a really simple problem :( I installed the seqinr library. I want to do an RSCU analysis. But i can't get it to work in even the simplest case. for example, if i have a string read in: > newdata5 $testseq [1] "agtgagatgatagatagatagatagatagatagatagaccccccagata" and then i perform an RSCU analysis on it... >

Hello, I'm plotting an xyplot where a continuous var recorded every min is plotted on y, and time expressed as HH:MM:SS on x, as follows : xaxis=list(tick.number=12,rot=90) lst=list(x=xaxis) xyplot(upt$LOAD_1 ~ upt$TIME, data=upt, type=c('g','p', 'r'), scales=lst) On the x-axis, every time label is drawn and the label quickly become unreadable as they overlap on each

Hi, I make heavy use of verbose statements in my code, verbose output that can be enabled/disabled via an argument. Here is a dummy example: foo <- function(n=10, verbose=FALSE) { res <- 0; for (k in 1:n) { if (verbose) cat("Iteration ", k, "...\n", sep=""); res <- res + k; if (verbose) cat("Iteration ", k,

my system.reg contains the following fonts [Software\\Microsoft\\Windows\\CurrentVersion\\Fonts] 1139543017 "Bitstream Vera Sans Bold (TrueType)"="VeraBd.ttf" "Bitstream Vera Sans Bold Oblique (TrueType)"="VeraBI.ttf" "Bitstream Vera Sans Mono Bold (TrueType)"="VeraMoBd.ttf" "Bitstream Vera Sans Mono Bold Oblique

my user.reg contains the following external fonts Software\\Wine\\Fonts\\External Fonts] 1139540729 "Bitstream Vera Sans Bold (TrueType)"="VeraBd.ttf" "Bitstream Vera Sans Bold Oblique (TrueType)"="VeraBI.ttf" "Bitstream Vera Sans Mono Bold (TrueType)"="VeraMoBd.ttf" "Bitstream Vera Sans Mono Bold Oblique

Hi, The french community of Xen: http://xenfr.org/ provides differents VM available here: http://ftp.ooofr.org/~anivard/VMhosts/ [ ] CentOS4.tar.bz2 04-Apr-2005 05:22 334M [ ] DebianWoody.img.bz2 04-Apr-2005 04:38 98.7M [ ] DebianWoody.tar.bz2 04-Apr-2005 05:24 74.0M [ ] FC4.disk.bz2 12-Feb-2006 20:45 310M [ ] FedoraCore3.img.bz2

Hi Everyone. I have a simple problem but don't know, how to get along. how can I convert the vector a<-c("0,01","1,00") in a vector b<-c(0.01,1.00) Thank you for suggestions M.Kirschbaum [[alternative HTML version deleted]]