Displaying 20 results from an estimated 500 matches similar to: "Excel Add-in"
2003 Jun 19
3
sciViews
Bonjour,
J'ai t?l?charg? SciViews Insider que je trouve tr?s convivial.
Par contre, je n'arrive pas ? comprendre comment enregistrer un script R en type de fichier R justement.
Mes programmes fonctionnent tr?s bien, mais SciViews me propose uniquement de les enregistrer au format txt sous un type de fichier "bloc notes".
Comment les enregistrer avec l'extension .R comme le
2002 Mar 07
2
Statconnector and Excel
Hi,
I'm trying to combine a VBA macro and a R package. I've installed the R-(D)COM and the R-excel interface by Neuwirth. They seem to work both. However I would like to display the r-generated data in an Excel sheet as an array but I don't manage.
Here is an example of my source:
Sub doR()
Call RInterface.StartRServer
Call RInterface.RRun("library(mdnn)")
Call
2003 Jun 26
3
create help files
Hello,
I have to create help files on R.
I used the "package.skeleton" function which allowed to me to create a personal package with my list of functions.
But I don't understand what I have to install to use these.
That needs the tools to build packages from source to be installed.
I will need the files in the R binary Windows distribution for
installing source packages to be
2002 Jun 26
6
Samba 2.2.5 and printers
I'm currently having a problem with the new released Samba 2.2.5: I cannot print anymore on my shared printer. What is strange is that It worked fine with samba 2.2.4, but now I got an access denied whenever I try to access the printer...
/var/spool/lpd/samba is chmod 777 and the username is in the group lp
Here is part of my smb.conf:
[global]
workgroup = HOME
netbios name =
2002 May 02
2
a question
Hi,
I have a program written in R which is good on the version 1.2, but for
the fallowing versions of R, an error always is at the same place.
That is at the level of the fallowing line:
Sur<-
getInitial(res2[m:M,2]~SSasymp(res2[m:M,1],Asymp,resp0,lrc),data=res2)
Error in eval(expr,envir,enclos):numeric envir arg not of length one
I don't know at all this langage for the instant.
2002 Jun 28
0
Tr: RE: Samba 2.2.5 and printers
Ok, I solved the problem by myself. The problem was that the users with wich I tried to connect to the printer where defined as admin users, and I declared root as an invalid user in the samba configuration, so it always give me an access denied because it tried to connect as root.
Anyway thanks for the time you waste trying to help me ;-)
----Message r?exp?di?----
>Date: Thu, 27 Jun 2002
2004 Feb 03
0
GEE
Bonjour,
J'etudie une population de chevaux en captivite. Je souhaite identifier le ou les facteurs qui influencent la fecondite des femelles (=nombre de poulain= 0 ou 1) depuis 1995 jusqu'a 2003. Les variables explicatives sont donc disponibles pour les femelles par annee :
fem1_annee1
fem2_annee1
fem3_annee1
fem1_annee2
fem2_annee2
fem3_annee2
fem4_annee2
etc.
Le nombre de femelles
2001 Nov 19
1
Pb w2k <-> samba
hello,
1)i have samba 2.2.2 running on HPUX11.0 64 bits
and i have the folowing message in my user log:
[2001/11/19 20:29:04, 0] smbd/nttrans.c:(1762)
call_nt_transact_ioctl: Currently not implemented.
[2001/11/19 20:29:04, 0] lib/util_sec.c:(94)
Failed to set gid privileges to (-1,-2) now set to (0,0) uid=
(0,0)
[2001/11/19 20:29:04, 0] lib/util.c:(1055)
PANIC: failed to set gid
2) when i
2003 Jun 27
1
R-help Digest, Vol 4, Issue 27 ( -Reply)
Hi,
I am out of town and will get back to you on the 13th of July.
Leo
>>> "r-help at stat.math.ethz.ch" 06/27/03 00:32 >>>
Send R-help mailing list submissions to
r-help at stat.math.ethz.ch
To subscribe or unsubscribe via the World Wide Web, visit
https://www.stat.math.ethz.ch/mailman/listinfo/r-help
or, via email, send a message with subject or body
2009 Nov 30
1
RSQLite does not read very large values correctly
Hello,
I am trying to import data from an SQLite database to R.
Unfortunately, I seem to get wrong data when I try to import very large
numbers.
For example:
I look at the database via SQLiteStudio(v.1.1.3) and I see the following
values:
OrderID Day TimeToclose
1 2009-11-25 29467907000
2 2009-11-25 29467907000
3 2009-11-25 29467907000
Now I run this R Code:
>
2000 May 22
1
write_socket_data: write failure
(Server :Mandrake 7, Samba 2.0.6)
(Client : PC Win95 and Win 98)
Samba's work fine since one year but yesterday
We had a big problem in my college
Lots of PC's client can't connect (invalid password).
In the samba's log we read :
> [2000/05/19 12:15:21, 1] smbd/service.c:close_cnum(568)
> renoir (192.168.84.189) closed connection to service valancee
> [2000/05/19
2001 Apr 13
1
Windows 9x diskless from a samba server
Hi
Is there a possibility to run diskless PCs under Windows 98 or
Windows ME with all the files located on a samba server ?
TIA
Zack
----- La messagerie itin?rante sans abonnement NetCourrier -----
Web : www.netcourrier.com - Minitel : 3615 NETCOURRIER
T?l?phone : 08 36 69 00 21
2011 Apr 16
2
Chinese character is not shown properly for some programs
Just dived into linux recently and spent a whole day on trying geing chinese programs working properly in wine. The situation is that some chinese programs (like eMule) display Chinese character very nicely while some others can not.
Here is the screenshot:
[Image: http://www.jg300.com/www/Screenshot-dzh.png ]
What I have done:
1. apt-get ttf-wqy-microhei
2. Copy the downloaded font to
2012 Feb 29
1
codon usage bias
Hey guys, I have what i think is a really simple problem :(
I installed the seqinr library. I want to do an RSCU analysis.
But i can't get it to work in even the simplest case. for example, if i have
a string read in:
> newdata5
$testseq
[1] "agtgagatgatagatagatagatagatagatagatagaccccccagata"
and then i perform an RSCU analysis on it...
>
2009 Jun 20
4
Customize axis labels in xyplot
Hello,
I'm plotting an xyplot where a continuous var recorded every min is plotted
on y, and time expressed as HH:MM:SS on x, as follows :
xaxis=list(tick.number=12,rot=90)
lst=list(x=xaxis)
xyplot(upt$LOAD_1 ~ upt$TIME, data=upt, type=c('g','p', 'r'), scales=lst)
On the x-axis, every time label is drawn and the label quickly become
unreadable as they overlap on each
2013 May 23
0
Code compilation: Drop certain statements in a function before calling it multiple times?
Hi,
I make heavy use of verbose statements in my code, verbose output that
can be enabled/disabled via an argument. Here is a dummy example:
foo <- function(n=10, verbose=FALSE) {
res <- 0;
for (k in 1:n) {
if (verbose) cat("Iteration ", k, "...\n", sep="");
res <- res + k;
if (verbose) cat("Iteration ", k,
2006 Feb 09
0
How to set the default font set from the fonts of system.reg?
my system.reg contains the following fonts
[Software\\Microsoft\\Windows\\CurrentVersion\\Fonts] 1139543017
"Bitstream Vera Sans Bold (TrueType)"="VeraBd.ttf"
"Bitstream Vera Sans Bold Oblique (TrueType)"="VeraBI.ttf"
"Bitstream Vera Sans Mono Bold (TrueType)"="VeraMoBd.ttf"
"Bitstream Vera Sans Mono Bold Oblique
2006 Feb 09
1
How to set the default font set ?
my user.reg contains the following external fonts
Software\\Wine\\Fonts\\External Fonts] 1139540729
"Bitstream Vera Sans Bold (TrueType)"="VeraBd.ttf"
"Bitstream Vera Sans Bold Oblique (TrueType)"="VeraBI.ttf"
"Bitstream Vera Sans Mono Bold (TrueType)"="VeraMoBd.ttf"
"Bitstream Vera Sans Mono Bold Oblique
2006 Feb 16
1
Virtual Machines Linux examples...
Hi,
The french community of Xen: http://xenfr.org/
provides differents VM available here:
http://ftp.ooofr.org/~anivard/VMhosts/
[ ] CentOS4.tar.bz2 04-Apr-2005 05:22 334M
[ ] DebianWoody.img.bz2 04-Apr-2005 04:38 98.7M
[ ] DebianWoody.tar.bz2 04-Apr-2005 05:24 74.0M
[ ] FC4.disk.bz2 12-Feb-2006 20:45 310M
[ ] FedoraCore3.img.bz2
2003 Sep 12
7
convert a Character-string to a number
Hi Everyone.
I have a simple problem but don't know, how to get along.
how can I convert the vector
a<-c("0,01","1,00")
in a vector
b<-c(0.01,1.00)
Thank you for suggestions
M.Kirschbaum
[[alternative HTML version deleted]]