similar to: Similarity matrix

Hi, I have two global raster maps, each of the same variable but from different sources. The values range from 0 to 5 in whole numbers. Is there a statistical test in R that can quantify the similarity of the spatial patterns (i.e., highs and lows)? Thanks, -- View this message in context: http://r.789695.n4.nabble.com/map-similarity-spatial-autocorrelation-in-R-tp4647877.html Sent from the

Hello. I'm looking for a fast way to group by similarity many (5-10k) long (2-10k points) time series. Using PAM on distance matrix obtained via as.dist(1-abs(cor(data))) produces usable results but it's rather slow and doesn't catch slightly shifted time series. DTW implementation from package 'dtw' is orders of magnitude slower even with global window constraints which

I have been reading a paper whereby the authors took values from Sorensons dissimilarity index and values from a percentage similarity index and applies G-Testing to the table of values. This is carried out to assess the differences in spider faunas (Strattton and Uetz, 1979). I like the method but have been trying to work out what function in R to use to get the percentage similarity. I have

Hi, I would like to know the similarity between variables, but I don't exactly how begin and as from what dataframe or matrix! I have a matrix where in row I have 'Good', 'Medium','Bad' and in columns I have my Criterions ! What function and package should I use? Thanks a lot Sabine --------------------------------- ils, photos et vidéos ! [[alternative

Dear all, I am using a program that generates similarity matrices in the following non-redundant pairwise format. a b 0.4 a c 0.5 a d 0.3 b c 0.9 b d 0.6 c d 0.2 matrix(c('a','a','a','b','b','c','b','c','d','c','d','d',.4,.5,.3,.9,.6,.2),byrow=F,nrow=6) I would like to convert this to a

I'm interested in clustering my data using the Gower Similarity Coefficient, and I was wondering if R is capable of using that metric Timothy Rye [[alternative HTML version deleted]]

>x=c(3.05176E-05,0.000457764,0.003204346,0.0138855,0.04165649,0.09164429,0.1527405,0.1963806,0.1963806,0.1527405,0.09164429,0.04165649,0.0138855,0.003204346,0.000457764,3.05176E-05) >y=c(0.0000306,0.0004566,0.0031985,0.0139083,0.0415539,0.0917678,0.1528134,0.1962831,0.1962994,0.1527996,0.0917336,0.0415497,0.0139308,0.0031917,0.0004529,0.0000301) I tried chisq.test, t-test, prop.test, etc,

Hello, It's just a strange coincidence that someone posted just very recently a question about matching. I know there are several match function in the base package (such as match, pmatch, charmatch, and the gsub etc) but I can't seem to use them wisely to be able to get what I need. suppose I have the following strings: "tets" "estt" "rtes7"

I am doing hierarchical clustering with cluster package.  I couldnot find similarity measures like matching coefficient, Jaccard coefficient and sokal and sneath. Could anyone please tell package with similarity measures for binary data? kind regards, Ms.Karunambigai M PhD Scholar Dept. of Biostatistics NIMHANS Bangalore India From cricket scores to your friends. Try the Yahoo! India

hi all, I am doing hierarchical clustering using similarity measures for binary data using package ade4 and hclust function. For method=8 and method = 9 of dist.binary, I am getting Na values. Hence, hclust function is giving error as Error in hclust(d8, method = "ward") :   NA/NaN/Inf in foreign function call (arg 11). I think the fact that due to zero in the denominator of the

Hello R-users, I've got a file with individuals as colums and the clusters where they occur in as rows. And I wanted a similarity matrix which tells me how many times each individual occurs with another. My eventual goal is to make Venn-diagrams from the occurence of my individuals. So I've this: cluster ind1 ind2 ind3 etc. 1 0 1 2 2 3 0 1 3

Dear All, I need to estimate the level of similarity of two strings. For example: string1 <- c("depending","audience","research", "school"); string2 <- c("audience","push","drama","button","depending"); The words in string may occur in different order though. What function would you recommend to use

Hi, I just started to use R for my Phd. I have to write a Formula by witch, given two matrices of vectors (electrostatic potential map) I shall calculate the similarity between them. Could you please tell me if I'am doing it right. The complecte formula is attached to an image file the script #!/usr/bin/env Rscript options(max.print=2000000) x<-read.table("a")

Hi, I'm Pina and I'm a student in geology. I'm working with spectral profile of sand and I have to find the similarity between one spectral profile selected by hyperspectral image anche one that I created to mix different percentage of 4 mineral component. I have to find the best mix of percentage of this 4 mineral in order to have the best likeness with the spectral profile chose by

Dear R-People, I am trying to measure distances between an empiric vector and two random vectors. Since one of the synthetic vectors has different length from the empirical one, I tried to introduce 0s to make all vectors have the same length, but this introduces a bias in the measurement. Since I have a lot of simulations of the two random vectors and I can boxplot them, I am thinking about

This is a question about how to calculate similarities/distances among items that are classified by hierarchical attributes for the purpose of visualizing the relations among items by means of clustering, MDS, self-organizing maps, and so forth. I have a set of ~260 items that have been classified using two sets of hierarchically-organized codes on the basis of form and content. The data looks

Hi everybody! I have intended to use library(lsa) on R 64-bits for Windows but it was not possible. Every time I try to launch library(lsa) function R give me back next message: Loading required package: SnowballError : .onLoad failed in loadNamespace() for 'Snowball', details: call: NULL error: .onLoad failed in loadNamespace() for 'rJava', details: call: stop("No

Hi group, I've been thinking of calculating euclidean distance between each column of a data frames that each consists of standardized numerical columns. However, I don't know if there's a way of summarizing the overall distance by some kind of metrics. If anyone know a proper way of doing so and/or a package I would greatly appreciate your suggestions. Thanks very much! Kel --

Hi, I want to group a large list (20 million) of strings into categories based on string similarity? The specific problem is: given a list of DNA sequence as below ACTCCCGCCGTTCGCGCGCAGCATGATCCTG ACTCCCGCCGTTCGCGCGCNNNNNNNNNNNN CAGGATCATGCTGCGCGCGAACGGCGGGAGT CAGGATCATGCTGCGCGCGAANNNNNNNNNN CAGGATCATGCTGCGCGCGNNNNNNNNNNNN ...... ..... NNNNNNNCCGTTCGCGCGCAGCATGATCCTG

Lucene, and perhaps most search engines, are biased towards small fields with little content (where thus the term frequency is higher). Lucene has the option to define a custom (Similarity) class to calculate the similarity between two fields (custom calculation of lengthNorm and tf) in different documents. But how do I do this in ferret? (I know to boost a field, but this is not what I