similar to: Problems with Login Engine/rake

Hi everybody, I am new to rails. I get the following error when run the rake engine:migrate for the engine login_engine. ------------------------------------------------------------------------ gbalaji:~/projects/test/vendor/plugins/login_engine gopalbalaji$ rake engine_migrate ENGINE=log --trace (in /Users/gopalbalaji/Projects/test) ** Invoke engine_migrate (first_time) ** Invoke

Hi there, How can I run rake commands from a rake migration? I''m looking to run rake engine_migrate and others commands from a migration in order to migrate my engines along with my core app. Any advice is appreciated. Thanks, Jason

I''m trying to install the login_engine. I installed the engine system and the login_engine, and now I''m trying to migrate the database schema, as detailed here: http://api.rails-engines.org/login_engine/. The commands I''ve tried are: rake engine_migrate ENGINE=login which fails with "Don''t know how to build task

Hi all, I'm using Ubuntu 14.04 samba 4.1.6 packages, attempting to set up a server for file shares AD clients can use. My previous setup was a simple AD join with a user map file (1 to 1 AD to unix user) that i've been migrating for approximately 7 years, and with the last 2003 AD server removed from the network it stopped working (2008 R2 DC's now). After approximately 2 weeks of

2015-05-04 13:01 GMT+02:00 Rowland Penny <rowlandpenny at googlemail.com>: > On 04/05/15 04:02, Carl Gherardi wrote: > >> Hi all, >> >> I'm using Ubuntu 14.04 samba 4.1.6 packages, attempting to set up a server >> for file shares AD clients can use. My previous setup was a simple AD join >> with a user map file (1 to 1 AD to unix user) that i've

Dear all, I wrote the following batch script on a iMac, and ran it on a linux mosix cluster. tu <- read.table("cage.mm5.tags.rna_lib.CAA-CAJ.tu-reshape.table") tu_reshaped <- t(reshape(tu[1:50,], direction="wide", timevar="tu", idvar=c("rna","lib"))) write.table(tu_reshaped, "cage.mm5.tags.rna_lib.CAA-CAJ.tu-reshaped.table")

Hi, Everything was working fine. Then I upgraded Rake to 0.7.0. Now, when I do a "rake engine_migrate", I get: ~/Projects/cisv/trunk joevandyk$ rake engine_migrate (in /Users/joevandyk/Projects/cisv/trunk) The db/migrate directory for engine ''login_engine'' appears to be missing. Should be:

Hi, I''m trying to get the UserEngine running. I have installed the LoginEngine, added the essential lines to environment.rb / application.rb and application_helper.rb. Worked fine. Then I did the same with the UserEngine and when trying to set up the db: rake engine_migrate ENGINE=user I get: Migrating engine ''user_engine'' rake aborted! stack level too deep But...

Hello, A newbie to R. I am trying to use the exonmap package in R. According to the docs, the xmapDatabase() command should read the config file with all the connection parameters and connect to the DB. But i get the error shown below.... > xmapDatabase("Human") Error in mysqlNewConnection(dbDriver(drv), ...) : RS-DBI driver: (could not connect cagadmin at mysql2.cag.chop.edu on

I just put the finishing touches on Substruct v0.06. As always, you can check out a demo over at http://substruct.subimage.com/ What''s new? Version 0.6 --------------------------------------- Added: - Tagging for products - Maintenance of product tags - Automatic image thumbnail / small size creation via RMagick Updated: - Better shopping cart experience with AJAX cart

Hello, I am trying to put my rails app on a host .So I presume the method to do this is to first do rake db_schema_dump and then copy it to the host and do rake db_schema_import. I use mySQL Ver 14.7 Distrib 4.1.14, for pc-linux-gnu (i686) using readline 4.3 ** Invoke db_schema_import (first_time) ** Invoke environment (first_time) ** Execute environment ** Execute db_schema_import rake

Hi. Background - I am working with a dataset involving around 750K observations, where many of the variables (8/11) are unordered factors. The typical model used to model this relationship in the literature has been a simple linear additive model, but this is rejected out of hand by the data. I was asked to model this via kernel methods, but first wanted to play with the parametric

On 04/05/15 04:02, Carl Gherardi wrote: > Hi all, > > I'm using Ubuntu 14.04 samba 4.1.6 packages, attempting to set up a server > for file shares AD clients can use. My previous setup was a simple AD join > with a user map file (1 to 1 AD to unix user) that i've been migrating for > approximately 7 years, and with the last 2003 AD server removed from the > network it

Wine release 20010510 on Linux 2.4.4 SMP compiled from source code. One in ten times, when I start wine (with an executable or without) the program will segfault. Notes: 1. This doesn't happen when I run wine under the debugger. 2. I turned on --debugmsg +all to see if I could pinpoint the reason. When it deosn't segfault, I get loads of debug messages. When it DOES fault, I get

Hey guys, I have what i think is a really simple problem :( I installed the seqinr library. I want to do an RSCU analysis. But i can't get it to work in even the simplest case. for example, if i have a string read in: > newdata5 $testseq [1] "agtgagatgatagatagatagatagatagatagatagaccccccagata" and then i perform an RSCU analysis on it... >

''rake rails:update'' is causing the below error for me when trying to upgrade my application. I''ve scowered Google and didn''t find much, has anyone else had this problem and solved it? C:\@cs\phase2>rake rails:update --trace (in C:/@cs/phase2) rake aborted! Don''t know how to build task ''rails:update''

Hi, With help from Oleg we got the right patches applied and NFS working well. Maximum performance was about 60 MB/sec. Last week that dropped to about 12.5 MB/sec and I cannot find a reason. Lustre clients all obtain 100+ MB/sec on GigE. Each OST is good for 270 MB/sec. When mounting the client on one of the OSSs I get 230 MB/sec. Seems the speed is there. How can NFS and Lustre be tuned

I''m just starting to try out wxruby. I downloaded the CVS and executed rake. I received the following error - SWIG Version 1.3.24 Copyright (c) 1995-1998 University of Utah and the Regents of the University of California Copyright (c) 1998-2004 University of Chicago Compiled with i386-redhat-linux-g++ [i386-redhat-linux-gnu] Please see http://www.swig.org for reporting bugs and further

Hi. I''ve just started using Ruby on Rails. Now I''ve got my first problem. I generated a new migration ''add_price'' and get the message:

I get the following error: rake test_units --trace ** Invoke test_units (first_time) ** Invoke test:units (first_time) ** Invoke db:test:prepare (first_time) ** Invoke environment (first_time) ** Execute environment ** Execute db:test:prepare ** Invoke db:test:clone (first_time) ** Invoke db:schema:dump (first_time) ** Invoke environment ** Execute db:schema:dump ** Execute db:test:clone **