Displaying 20 results from an estimated 100 matches similar to: "Can someone help plss"
2006 Feb 20
0
Can someone help plss
Copying the list on my reply, just in case it helps someone else too.
Remzi Aga wrote:
> I'll try to write you what i have done. First i installed the (
> icecast2_win32_v2.3.1_setup ) program.
> After that i klicked the edit configuration tool and i made some changes in
> that text area. The things i changed where only username, password, my
> ipadrees and i made the .ogg
2008 Jul 14
3
off topic question plss need ur help
Dear All,
I have been using centos 5.1 for quite some time as out DNS and mail server
and been workin fine
i use sendmail as my mail server
i did setup a backup mail server as per docs and ran th dns test from
http://www.checkdns.net
and it says both the mail servers are fine
but i would like to know the following
how would i really know if my main primary server is down all my mails r
goin
2007 Aug 03
2
graphic card drivers
hi,
I have just installed xen 3.0.x on debian etch. Im just newbie.
I would like to know is there any way to install my nvidia graphic card
driver on domains.
I couldnt install driver on dom0 because nvidia does not support xen kernel
_______________________________________________
Xen-users mailing list
Xen-users@lists.xensource.com
http://lists.xensource.com/xen-users
2007 Jan 29
2
Rxfax and Txfax on Asterisk 1.4
> AFAIK the current recommendation is to use HylaFax with something
called iaxmodem.
After having been through a lot of problems with RxFax and TxFax I
completely agree with this statement. Allthough the initial
configuration is a bit complicated, once you have this running you'll
get far better reliability.
Kind regards,
Ardjan Zwartjes.
2001 Nov 21
3
help - smbclient works: smbmount doesn't
Naturally, you tinker around with stuff long enough and you break it.
I am running Samba 2.2.2 on a Corel linux box and am attempting to connect
to a share on a windows XP system. At one point, this was working fine.
Then I spent time trying to reconfigure my kernel so that I could attach a
floppy tape drive and now I can connect with smbclient to the share, but I
cannot with smbmount. I have
2013 Jul 23
1
Heat Map for species - code from Numerical Ecology with R
Hello, I am relatively new to R and I am working through the code that is provided in the book Numerical Ecology with R and I have run across an error message that I can't seem to figure out. I am using the vegan, ade4, gclus and cluster packages. The code is as follows: # Ordered community table # Species are ordered by their weighted averages on site scores or <- vegemite(spe,
2003 Jun 22
4
Is this possible:
The hardware we are planning to use is:
Micronet SP5050 FXO Gateway
http://www.micronet.com.tw/Products/VoIP/SP5050.asp
Micronet SP5100 IP Phone
http://www.micronet.com.tw/Products/VoIP/SP5100.asp
We are hoping to use this hardware along with AsteriskPBX to replace our aging PBX system.
What I want to acheive is:
* Any incoming call from PSTN (via gateway) rings on the receptionists phone for
2004 Feb 06
1
How to get the pseudo left inverse of a singular squarem atrix?
>I'm rusty, but not *that* rusty here, I hope.
>
>If W (=Z*Z' in your case) is singular, it can not
have >inverse, which by
>definition also mean that nothing multiply by it will
>produce the identity
>matrix (for otherwise it would have an inverse and
>thus nonsingular).
>
>The definition of a generalized inverse is something
>like: If A is a
>non-null
2005 Jul 04
1
Asterisk 1.0.9 and FreeTDS
Hi all,
I have a working 1.0.7 installation and it is recording CDR to mysql. I am
using FreeTDS on the system currently to access our MS SQL 2000 server for
account verification, we may use it to store CDR records there in the
future.
I have decided to update the installation to 1.0.9. However, during "make",
I receive:
make[1]: Entering directory `/usr/src/asterisk/cdr'
gcc
2002 Oct 17
3
Mounting a windows share
How can I mount a windows share on a sun machine. I am also not able to find
out the smbmount on that machine.
Thanks
Vikas
2018 Dec 14
2
What is the web/listen file?
Hi
What is expected by the “checking for file /listen (/usr/local/share/Icecast/web/listen)
..... no such file or directory
In logs
?
Thanks
Robert
2010 May 11
3
Improving loop performance
R-users,
I have the following piece of code which I am trying to run on a dataframe (aga2) with about a half million records. While the code works, it is extremely slow. I've read some of the help archives indicating that I should allocate space to the p1 and ags1 vectors, which I have done, but this doesn't seem to improve speed much. Would anyone be able to provide me with advice on
2004 Apr 08
3
Re: : External access to voicemail
Hello steve. Here is a patch I wrote for app_voicemail.c which does
exactly as you describe. When the outgoing message is playing, if the
listener hits the "*" key, they're prompted for a mailbox and password,
whereupon they can check their voicemail as if they were using the internal
phone. I found no other way of doing this.
If you patch your app_voicemail.c, I have V1.44 from
2012 Feb 29
1
codon usage bias
Hey guys, I have what i think is a really simple problem :(
I installed the seqinr library. I want to do an RSCU analysis.
But i can't get it to work in even the simplest case. for example, if i have
a string read in:
> newdata5
$testseq
[1] "agtgagatgatagatagatagatagatagatagatagaccccccagata"
and then i perform an RSCU analysis on it...
>
2007 Aug 17
2
Date format on x-axis
Dear R users,
Plotting question from a R beginner...
When I try to plot a response through time, for example:
>Date<-c("2006-08-17", "2006-08-18", "2006-08-19", "2006-08-20")
>response<-c(4,4,8,12)
>as.Date(Date)
>plot(Date,response)
The dates on the graphic appear in spanish. This I guess is the default
way of plotting because my
2012 Nov 15
3
Can you have a by variable in Lag function as in SAS
Hello,
I want to use lag on a time variable but I have to take date into
consideration ie I don't want days to overlap ie:
I don't want my first time of today to match my last time of yeterday.
In SAS I would use :
data x;
set y;
by date tim;
previous=lag(tim);
if first.date then
do;
previous=.;
end;
run;
How can I do something similar in R? I can't find
2007 Jan 26
4
Sangoma card dying after 1hour
Hello List
I am having a rather big problem with a sangoma A104 card, I just installed to replace a Digium TE410 card, that was acting up.
But now we have a problem with the sangoma card. It runs great after being started, and calls proceed as normal, but after about 1 hour, it stops being able to make and receive calls.
If I run wanpipemon debug, can see that the card still receives
2005 Jul 13
5
build libshout and icecast under Windows
Hi folks, I'm kinda new on the list.
I've been trying to build libshout 2.1 and then
icecast 2.2.0 under Windows, using Visual Studio 7.0
(.net), but had lots of problems.
I've fetched needed packages including curl, iconv,
libxml2, libxslt, org, pthreads, theora, but I still
cannot find "implement.h", and the build reports
errors at linking such as "invalid or
2007 Mar 13
3
OCFSv2 in a mail cluster environment
Hello,
First, thanks to all the people who helped to license this software under
the GPL. This is a very important piece of work for the Free Software in the
Enterprise Market.
Just a few newbie questions. We've been thinking about implmenting a mail
cluster with a Fiber SAN (IBM DS-4000) and OCFSv2 as the storage
backend. The information on this volume will essentially be Postfix
Maildirs,
2007 Aug 01
1
need help.. n do apolosize
Dear All,
cd any one plss let me know how to subscribe to sendmail mailing lists..
i am not able to do it
apprecite n thanks
regards
simon
--
Network Administrator