similar to: [PATCH 01/10] arch:powerpc: return -ENOMEM on failed allocation

Signed-off-by: Allen Pais <allen.lkml at gmail.com> --- drivers/gpu/drm/gma500/mid_bios.c | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/drivers/gpu/drm/gma500/mid_bios.c b/drivers/gpu/drm/gma500/mid_bios.c index d75ecb3..1fa1633 100644 --- a/drivers/gpu/drm/gma500/mid_bios.c +++ b/drivers/gpu/drm/gma500/mid_bios.c @@ -237,7 +237,7 @@ static int

On Wed, 2017-09-13 at 13:02 +0530, Allen Pais wrote: > Signed-off-by: Allen Pais <allen.lkml at gmail.com> I think the changelog for this series of conversions should show that you've validated the change by inspecting the return call chain at each modified line. Also, it seems you've cc'd the same mailing lists for all of the patches modified by this series. It would be

In R version 2.6.1 (2007-11-26) and R version 2.6.1 Patched (2008-01-19 r44061) on openSUSE 10.2 (X86-64) > gctorture() > proc.time() Error: protect(): protection stack overflow The problem with this is that then R CMD check --use-gct foo ALWAYS FAILS with > cat("Time elapsed: ", proc.time() - get("ptime", pos = 'CheckExEnv'),"\n") Error in

Current core/Recommended Matrix package (0.999375-48) has been segfaulting against R 2.13-alpha/2.14-trunk for the last week or so (since R-2.13 was branched, when I started trying) when "run with R CMD check --use-gct": -------------- > pkgname <- "Matrix" > source(file.path(R.home("share"), "R", "examples-header.R")) >

Found the simpliest way of seeing I bug I encountered doing "R CMD check --use-gct": Just launch R (with --vanilla), and do this: > ?gctorture # this work > gctorture() > ?gctorture Error in gzfile(file, "rb") : can only weakly reference/finalize reference objects # this does not It seems that when gctorture() is on gzfile() doesn't work.

Hi, I'm having trouble matching the symbols/color of the key to match those specifiec in the plot. Here is the code I used: xyplot(GCR+GCT ~ FRAC, data=RWF, type=c("g","p"),cex=1.2,pch=c(22,21), xlab=expression(italic("f")),ylab=expression(italic("S")), key=list(points=list(pch=c(22,21),cex=1.2), text=list(c("Targeted Deletion","Random

Dear Deepayan and dear list, I notice a small inconsistency with the command completion of the R CMD check. --no-latex is deprecated sincs R 2.12.0 and defunct since 2.13.0 but the command line completion still suggests it: cb at cbdesktop:~/r-devel$ bin/R CMD check --no-<here I hit tab> --no-clean --no-examples --no-latex --no-vignettes --no-codoc --no-install

Dear Deepayan and dear list, I notice a small inconsistency with the command completion of the R CMD check. --no-latex is deprecated sincs R 2.12.0 and defunct since 2.13.0 but the command line completion still suggests it: cb at cbdesktop:~/r-devel$ bin/R CMD check --no-<here I hit tab> --no-clean --no-examples --no-latex --no-vignettes --no-codoc --no-install

I'm trying to network-boot a GCT Allwell set-top box without success. My frustration level is high. The problem seems to be that the Allwell is sending a RRQ with an option. tftp-hpa responds with an OACK, and waits for the corresponding ACK from the Allwell. The Allwell never sends that ACK, but instead continues with the same RRQ until timeout. Having read RFC1782, this makes me think

Hello, I was wondering whether there is a possobility to add File types to the list of filters known by R. I'm using the function choose.files in Windows. I have some files I always use and i would like to filter my option to these kind of files. I have some "atr", "cdt", "gct", "gmt" etc. Is there a way of telling R to filter only these files?

Signed-off-by: Allen Pais <allen.lkml at gmail.com> --- drivers/net/bonding/bond_alb.c | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/drivers/net/bonding/bond_alb.c b/drivers/net/bonding/bond_alb.c index c02cc81..89df377 100644 --- a/drivers/net/bonding/bond_alb.c +++ b/drivers/net/bonding/bond_alb.c @@ -864,7 +864,7 @@ static int rlb_initialize(struct bonding *bond)

Hello r-help, I try to fit birds counts over years using glm. I have done (with Estate and year as factors): Model1 <- glm(Females~Estate+Year+offset = log(area)), family = quasipoisson(link = log), na.action = "na.exclude") After I have calculated the prediction using: Pred1 <- predict(Model1, type = "response", na.action = "na.exclude") My question

Hey guys, I have what i think is a really simple problem :( I installed the seqinr library. I want to do an RSCU analysis. But i can't get it to work in even the simplest case. for example, if i have a string read in: > newdata5 $testseq [1] "agtgagatgatagatagatagatagatagatagatagaccccccagata" and then i perform an RSCU analysis on it... >

Hi I am trying this > x <- read.table("/home/kenji/1245/GDS1_2grps_.cls", header = F, skip = 2) > x <- read.table("/home/kenji/1246/MYCset.cls", header = F, skip = 2) Warning message: In read.table("/home/kenji/1246/MYCset.cls", header = F, skip = 2) : incomplete final line found by readTableHeader on '/home/kenji/1246/MYCset.cls' Here are the

Dear R-helpers, When installing a source package I can suppress the compilation of .chm files by using the --docs="normal" option. Is it also possible to suppress the creation and checking of .chm files when calling R CMD check ? best, ingmar

Hi all, Given a matrix: > mat [,1] [,2] [,3] [1,] 0 0 0 [2,] 3 3 3 [3,] 1 1 1 [4,] 2 1 1 How can I convert it to a list of strings: > desired_output [1] "aaa" "ttt" "ccc" "gcc" In principle: 1. Number of Column in matrix = length of string (= 3) 2. Number of Row in matrix = length of vector ( = 4). 3.

repost from the subscribed address... --- On Fri, 1/4/11, Hin-Tak Leung <htl10 at users.sourceforge.net> wrote: > --- On Wed, 30/3/11, Douglas Bates > <bates at stat.wisc.edu> > wrote: > > > I isolated the problem and tested then committed a > fix. I > > am going to > > ask Martin to upload the new release as I have gotten > out > > of sync

Hello I am thinking of buying this card to and wanted to know if this NIC is supported. The card is a Sun Microsystems PCI-X Quad-Port Gigabit Ethernet Adapter QGEXPCI 501-6738-10. Can't find any info on how well the card plays with centos and also proxmox ve (if any of you use that distro ) If things don't seem to work I may bite the bullet and buy an Intel card thanks Rafeal Stewart

Buenos días, estoy haciendo unos mapas con ggplot, con 29 categorías, por lo que tengo que utilizar library(RColorBrewer) para disponer de suficientes colores. El problema es que al hacerlo acorde a dos variables distintas (color=var1 y color=var2), cuyas 29 categorías son obviamente las mismas, les da distintos colores y no puedo comparar los mapas. Muchas gracias, Manuel

>I tried the commands that you have presented and I running into >problems. I tried the ideology that you presented with both 32 and 16mb >configurations with no luck. Is there something that I'm missing? > >The win98se boot disk boots (just downloaded it from bootdisk today) so >I used that as a based for the boot file. > >Item 8c works fine (1.44 image) but 8b