similar to: [LLVMdev] [cfe-dev] GCC 4.7.2 will have Win64 SEH (by default)

Hi! I try to add more functionality to Win64 exception handling, based on the posted patches from Charles Davis and João Matos. But I have a question about how to map SEH handling to LLVM IR. The basic structure of SEH in C is as follows: __try { // Do something. } __except (filter(GetExceptionCode(), GetExceptionInformation())) { // Handle exception } How to

Hi Kai, > I try to add more functionality to Win64 exception handling, based on the posted > patches from Charles Davis and João Matos. > > But I have a question about how to map SEH handling to LLVM IR. are you sure you don't mean: map LLVM IR to SEH? I.e. are you talking about how to implement LLVM's "dwarf" exception handling intrinsics and landingpad

I apologize for the first message. :) --------------------------------------- I have an FTP server running in the DMZ section of my home network. It uses port 23000 for connection and ports 19990 to 19994 for data transfer. I have setup the following rule for outside people to connect to it: DNAT net dmz:192.168.2.2 tcp 23000 I''m at work right now and I can''t use

Hi! LLVM currently does not implement the implicit TLS model on Windows. This model is easy: - a thread local variable ends up in the .tls section - to access a thread local variable, you have to do (1) load pointer to thread local storage from TEB On x86_64, this is gs:0x58, on x86 it is fs:0x2C. (2) load pointer to thread local state. In general, the index is stored in variable

Hi Chandler, Kai contributed the WIN64 SEH patch some time ago on llvm-commits: http://lists.cs.uiuc.edu/pipermail/llvm-commits/Week-of-Mon-20131118/196105.html it was never completed. Kai also responded in this thread. I opened a phabricator for the patch http://reviews.llvm.org/D3418 Yaron 2014-04-18 12:31 GMT+03:00 Chandler Carruth <chandlerc at google.com>: > > On Tue,

Hi Chandler, There were five SEH releated patches posted in two threads in the last days. Two different patches in Martell e-mail starting this thread: the win64 seh (llvm) and the register names Three more related SEH patches in another thread: one for win64 seh clang, one for MinGW toolchain and another for unreachable prologue. To clarify and allow proper reviews for the different patches I

Hi, On 15.04.2014 23:44, Vadim Chugunov wrote: > Hi, > I am curious - how does clang deal with epilogue-less functions that > result from _Raise_Exception being marked 'noreturn'? > I've also been playing with Kai's patch, and discovered that this tends > to greatly confuse Windows stack unwinder in cases when noreturn call is > at the end of a function, so

In summary we have no less than six patches required to support Win64 SEH MinGW. The first five could be committed after review and LGTM but the last one also requires Ray Donnelly approval. Please comment in the Phabricator so the comments would be kept in context. 'unreachable' trap http://reviews.llvm.org/D3417 Win64 SEH (LLVM) http://reviews.llvm.org/D3418 Win64 SEH (clang)

On Sun, Dec 4, 2011 at 9:18 AM, Kai <kai at redstar.de> wrote: > Hi! > > LLVM currently does not implement the implicit TLS model on Windows. This > model is easy: > > - a thread local variable ends up in the .tls section > - to access a thread local variable, you have to do >  (1) load pointer to thread local storage from TEB >      On x86_64, this is gs:0x58, on

Hi, I'd like to submit a patch to match the clang patch on the front end. http://lists.cs.uiuc.edu/pipermail/cfe-commits/Week-of-Mon-20140414/103257.html The front end doesn't need this patch to work but it's still important. This is mostly based on work done by kai from redstar.de Could I get some feedback on this? I'm not sure if the emitting of the register names will effect

I don't remember anything other that what I've written in the bug João has mentioned. Probably something like this patch http://llvm.org/bugs/show_bug.cgi?id=14410#c6 ? 2013/2/20 João Matos <ripzonetriton at gmail.com>: > I think so. There have been other reports lately related to this being > wrong. > > http://llvm.org/bugs/show_bug.cgi?id=14410 > > CC'ing

Hi everyone! I need to create a rule that return back the packages sender. For example, if the IP 200.xxx.xxx.xxx tries to connect to my firewall in one specific port, the rules turns back the connection to 200.xxx.xxx.xxx. With this rule the Engineers Department will test some equipments with GSM chips. One point to observe is that we don''t know witch IP will connect to this rules.

The patch looks incorrect. The code just needs to handle \1 properly and clang extended to add explicit \1 to the names which does not require mangling. I do not think that moving whole mangling to clang is a good idea, because then everyone who uses LLVM to call WinApi functions will need to mangle by hands. On Wed, Feb 20, 2013 at 11:25 PM, Timur Iskhodzhanov <timurrrr at google.com>

Hello Ilia, On 17 February 2017 at 11:14, Ilia Mirkin <imirkin at alum.mit.edu> wrote: > On Fri, Feb 17, 2017 at 10:54 AM, João Paulo Rechi Vita > <jprvita at gmail.com> wrote: >> I'm happy to file >> a bugzilla entry and provide any other needed information or help with >> testing. Are nouveau bugs tracked on bugs.kernel.org or the fdo >> bugzilla?

Hi everyone! First of all, sorry about my bad English and the e-mails extension. I need some help to implement a VPN connection using shorewall and openswan as IPSec Tunnel. My network map: CLIENT VPN APPLIANCE --> +++INTERNET+++ --> FIREWALL --> OPENSWAN SERVER (DMZ) I have two VPN connections with two different subnets to the other end. The two of then are correctly established.

Anton, what do you think of David's patch with this test case? OK to commit that? On Wed, Feb 20, 2013 at 12:43 PM, Anton Korobeynikov < anton at korobeynikov.info> wrote: > The patch looks incorrect. The code just needs to handle \1 properly > and clang extended to add explicit \1 to the names which does not > require mangling. > > I do not think that moving whole

Dear all, I would like to know how can I compute the length of a string in a dataframe. Example: SEQUENCE ID TGCTCCCATCTCCACGG HR04FS000000645 ACTGAACTCCCATCTCCAAT HR00000595847847 I would like to know how to compute the length of each SEQUENCE. Best regards, João Fadista [[alternative HTML version deleted]]

On Tue, Feb 19, 2013 at 2:13 PM, Duncan Sands <baldrick at free.fr> wrote: >> My question: Is there an easy way of disabling the name-mangling part >> but keep the rest of the CC that I missed? > if you use "\1" + "usual name", it will disable name mangling if you are > lucky. A leading \1 is LLVM's way of saying: leave this name alone! Seems like

Hi Everyone! I''m having problems to redirect an UDP port to an external server. My firewall have 4 interfaces: NET, LOC (192.168.0.0/24), DMZ(192.168.1.0/24), CMTC(10.0.0.0/24). On CMTC interface I have a direct connection to another network using a VPN link. I need to redirect an UDP port to on server (10.1.0.2) on CMTC zone using my local IP (192.168.0.1) for gateway. I will use

I added a linux server to the Active Directory domain, I realized that the samba-winbind package uses the smb.conf file, but I also need to use the same linux server with shares, if I install the samba package, this package use the smb.conf file. Is there a solution? Then i have problem with 2 services. Example systemctl services: smb.service winbind.service My system is Centos 7. --