Displaying 20 results from an estimated 300 matches similar to: "SocketError in EmailController#correspond"
2010 Mar 10
6
Email section
Sir , I want to implement email section in ma web application..
so i found the method ''server_setting'' for it...
Following is the method:
config.action_mailer.server_settings = {
:address => "smtp.gmail.com" ,
:port => 25,
:domain => "gmail.com" ,
:authentication => :login,
:user_name => "manish" ,
:password =>
2009 Nov 11
1
getaddrinfo: nodename nor servname provided, or not known
Hi there,
If I want to create email within my application (in production), how
is this best achieved??
Following the railsspace tutorial, it only really suggests to
use :smtp.
I''d read on another site that to generate emails locally, i need to
use :sendmail instead... However - I havent seen any decent examples
of how to get this configured to be able to send emails within my
local
2008 May 03
2
ActionMailer Multiple recipients
I am using ActionMailer to send mails. I want to send mails to
multiple recipients which I get from a view. Here is the controller
code.
def groupcorres
user = User.find(session[:user_id])
address = Array.new
lines = Array.new
args = params[:id].to_s # params[:id] is an array of user screen
name. ex: j_doe, d_john
lines = args.split(",")
for line in lines
2006 Jan 24
14
A bad day with Action Mailer
Hi, I''ve setup Action Mailer today to email the contents of a form.
Every seemes fine except when the email is sending.
Here is the error I get on the production server:
SocketError (getaddrinfo: Name or service not known):
/usr/lib/ruby/1.8/net/protocol.rb:83:in `initialize''
/usr/lib/ruby/1.8/net/protocol.rb:83:in `new''
2012 Apr 25
3
R shell script
Hey guys,
Does anyone have an example of a REALLY simple shell script in R.
Basically i want to run this command:
library(MASS)
wilcox.test(list1,list2,paired=TRUE,alternative=c("greater"),correct=TRUE,exact=FALSE)
in a shell script something like this:
#!/bin/bash
R
library(MASS)
for i in *.out
do
wilcox.test($i,${i/out}.out2,paired=TRUE) >> $i.out
done
that i can run on a
2006 Jul 15
3
SocketError when trying to install Rails with RubyGems
I downloaded RubyGems 0.9.0 and successfully extracted and built it by
running "sudo setup.rb".
Then I try to install Rails via this command:
"sudo gem install rails --include-dependencies"
But I get this error everytime:
ERROR: While executing gem ... (SocketError)
getaddrinfo: no address associated with nodename
Can someone point me in the right direction?
Thanks
2010 Feb 25
0
SocketError: getaddrinfo: Name or service not known --> error while running test case
Hi all,
I am getting the below error when I try to run my test case. I have
already started selenium RC server (port:4444).. Also I have specified
" 127.0.0.1 localhost " in /etc/hosts ...
:ruby test1.rb
Loaded suite test1
Started
E
Finished in 0.022698 seconds.
1) Error:
testfestool(Test1):
SocketError: getaddrinfo: Name or service not known
2010 Jun 29
16
problem finding find current page
I have this bit of code in my email.controller
user = @current_user
story = @current_story
recipient = story.user
It doesn''t work because @current_story isn''t defined. How can I find the
current page to make this work?
--
Posted via http://www.ruby-forum.com/.
--
You received this message because you are subscribed to the Google Groups "Ruby on Rails: Talk" group.
2012 Mar 16
1
plot columns
Hey guys, can anyone help?
i have a sample table:
>table <- structure(c(4, 7, 0.2, 3, .1, 7, 222, 3, 10, 5, 11,
8, 8, 10, 7), .Dim = c(5L, 3L), .Dimnames = list(c("gene1",
"gene2", "gene3", "gene4", "gene5"), c("codon1", "codon2",
"codon3")))
>table
codon1 codon2 codon3
gene1 4.0 7
2012 Feb 17
1
basic help: graph multivariate analysis.
Hey guys, I'd really appreciate any help.
I have a multivariate analysis done, the output of which is:
> GraphData <-read.table("eigen.coa")
> GraphData
V1 V2 V3 V4
1 1 0.371970 0.8552 0.8552
2 2 0.061785 0.1420 0.9972
3 3 0.001211 0.0028 1.0000
4 4 0.000000 0.0000 1.0000
> summary(GraphData)
V1 V2 V3
2012 Feb 29
1
codon usage bias
Hey guys, I have what i think is a really simple problem :(
I installed the seqinr library. I want to do an RSCU analysis.
But i can't get it to work in even the simplest case. for example, if i have
a string read in:
> newdata5
$testseq
[1] "agtgagatgatagatagatagatagatagatagatagaccccccagata"
and then i perform an RSCU analysis on it...
>
2009 Aug 13
3
Plotting shaded areas
Hi
I would like to plot the variation of some mean values with time,
and have the standard deviation around the mean shaded on the plot.
I could not find a way to have the shaded area on the curve with the
default R commands,
do I need a special package to do that?
Or any idea of a way with the default R commands?
Many thanks
Thomas
--
Thomas Loridan
King's College email: thomas.loridan
2012 Mar 07
2
find points on a graph
Hey guys, Can anyone help?
I did a correspondance analysis and made a plot.
I also have a specific list of nodes that i want to find in my plot and want
to either color the nodes that appear in my list differently, or put some
kind of border around that group of nodes...
Would anyone know how to do this?
Also, would this post be more relevant here or in the bioconductor forum?
--
View this
2012 Mar 12
1
(no subject)
Hey guys,
if i do a correspondance analysis, e.g.:
table <- structure(c(4, 7, 0.2, 3, .1, 7, 222, 3, 10, 5, 11,
8, 8, 10, 7), .Dim = c(5L, 3L), .Dimnames = list(c("gene1",
"gene2", "gene3", "gene4", "gene5"), c("codon1", "codon2",
"codon3")))
Library(ca)
plot(ca(table))
is there a way that i can see
2012 Apr 23
1
check for difference.
Hello
I have two lists of numbers, each list is ~800 numbers long. I want to know
if the two lists are significantly different from each other.
Could anyone suggest what library in R to use?
I think maybe the mann-whitney test, as it is not parametric, but i am
unsure if it is suitable as my list of items are so long.So i am unsure
which library would suit best.
Aaral.
[[alternative HTML
2008 May 21
5
Recieve email from gmail using POP3
can someone help me out with this folder... im stuck and i cant trouble
shoot where is the error
thx alot~~~
Attachments:
http://www.ruby-forum.com/attachment/1982/mail4.zip
--
Posted via http://www.ruby-forum.com/.
--~--~---------~--~----~------------~-------~--~----~
You received this message because you are subscribed to the Google Groups "Ruby on Rails: Talk" group.
To post to
2010 Feb 08
0
recommending friends, using RoR's Mailer
Hi there, I wan tto be able to allow users to invite friends...
The action below is exactly the same as the code used to send a user
their username. Only difference is, I need to change the ''''user =
User.find_by_email(email)'''' part as obviously, I dont want to only
email people who are already on the site.
def invite
@title = "Invitation"
2007 Dec 17
2
undefined method `param_posted?'
I upgraded an app to 2.01 and can''t figure out why I am getting a
undefined method `param_posted?'' for #<ControlPanelController:
0xb748ba18>
The controller should be inheriting this.
class ControlPanelController < ApplicationController
--~--~---------~--~----~------------~-------~--~----~
You received this message because you are subscribed to the Google Groups
2008 Sep 03
2
Installing rgl
Hello.
I'm having trouble installing rgl. I have a theory as to the problem.
First, the error message and session info.
> install.packages("rgl")
trying URL 'http://probability.ca/cran/src/contrib/rgl_0.81.tar.gz'
Content type 'application/x-gzip' length 1636939 bytes (1.6 Mb)
opened URL
==================================================
downloaded 1.6 Mb
*
2003 Nov 10
5
OT : For the SQL gurus..
SQL help needed..
If I have a MySQL table with dialing codes and a corresponding
description (see below) and I want to lookup the best match for a phone
number.. What would the SQL look like to do it? or would it take more
than just SQL to get to the best result?
Thanks..
Later..
Example numbers, (random end digits so I don't know who's they are.)
00442085673456 - UK London