similar to: whoops - ADMw0rm is old stuff

On Fri, 26 Mar 1999, Thomas Biege wrote: > Date: Fri, 26 Mar 1999 09:34:10 +0100 (MET) > From: Thomas Biege <thomas@suse.de> > To: Jan-Philip Velders <jpv@jvelders.tn.tudelft.nl> > Cc: linux-security@redhat.com > Subject: Re: [Security - intern] [linux-security] *ALERT*: ADM Worm. Worm for Linux x86 found in wild. > The worm just exploits old security holes, so

Hi, some more info on the previous admw0rm alert. Fwd'd from BugTraq Greetings, Jan-Philip Velders ---------- Forwarded message ---------- Date: Fri, 26 Mar 1999 21:17:40 +0100 From: Mixter <mixter@HOME.POPMAIL.COM> To: BUGTRAQ@NETSPACE.ORG Subject: Re: ADM Worm. Worm for Linux x86 found in wild. The "ADM w0rm" is public and can be found at:

Alright, going ot ask this question in advance of doing bone headed tests. I have one application that does not understand the idea of /usr/local/ and insists on populating /usr. Of course it is closed source and commercial and it is the one they want to use. Below is the list of junk it shoves in /usr/share. Between the Type Reference guide and another email , I believe I can move this tree

A question on p-value of Unit Root Tests using “urca” toolbox There’s a function “punitroot” on unit root probability value punitroot(q, N = Inf, trend = c("c", "nc", "ct", "ctt"), statistic = c("t", "n"), na.rm = FALSE) To my knowledge, “c” means “const” or intercept, “nc” means no const or intercept, and “ct” means time trend

Hello, I want to compute Wainer et al's augmented subscore(2001) using IRT but I can't find any packages or relevant code. There is a 'subscore' package in R, but I think it only gives functions to calculate augmented subscores using CTT(classical test theory). Is there other package or code to compute subscores using IRT? If it is not, is there any plan to develop it in

I have no idea, but Google pointed me to this https://cran.r-project.org/web/packages/subscore/index.html Hth Ulrik "Hyunju Kim" <asdfg4882 at yonsei.ac.kr> schrieb am Di., 15. Mai 2018, 07:21: > > > > Hello, > > > > I want to compute Wainer et al's augmented subscore(2001) using IRT but I > can't find any packages or relevant code. > >

Hi there asterisk goes to 90% cpu usage when trying to authenticate a sip friend using realtime mysql, no other message does appear at cli and asterisk hungs; here some info: *CLI> realtime load sipfriends name 104 Jan 13 11:52:21 DEBUG[8928]: res_config_mysql.c:109 realtime_mysql: MySQL RealTime: Retrieve SQL: SELECT * FROM sipfriends WHERE name = '104' Jan 13 11:52:21 DEBUG[8928]:

-=> To moderator: I don't know whether it's wise to release the FTP-location I would recommend everyone to just look over their daemons, and run something like nessus against theirselves... Greetings, Jan-Philip Velders ---------- Forwarded message ---------- Date: Thu, 25 Mar 1999 16:26:59 -0700 From: "Ben Cantrick (Macky Stingray)" <mackys@MACKY.RONIN.NET> To:

I am trying to simulate a dataset using Parallel Latent CTT model and this is what i have done so far: (START) #Importing psych library for all the simulation related functions library(psych) # Settting the working directory path to C:/NCME path="C:/NCME" setwd(path) #Using the function to generate the data GenData <- congeneric.sim(N=500, loads =

Hi Folks, Please, when I ask the option reg.line at the scatterplot in package car, the OLS models includes a constant? If not how can I do it sing the following code: scatterplot(lfirms ~ lscale, data=dataset, reg.line=lm, smooth=FALSE, labels=FALSE, span=0.5, xlab="Relative Plant Fixed Cost", ylab="Relative Number of Firms", pch=c(18),

-----BEGIN PGP SIGNED MESSAGE----- Hash: SHA1 Hi i've installed asterisk by last cvs and i note res_parking.c is not anymore there; chan_capi-0.3.4b INSTALL file require: in /etc/asterisk/modules.conf insert the line: load => res_parking.so load => chan_capi.so running asterisk i get: [app_capiCD.so]Jul 21 15:32:26 WARNING[1076988448]: loader.c:242 ast_load_resource:

-----BEGIN PGP SIGNED MESSAGE----- Hash: SHA1 Ddoes it feasible with * to capture a call? when arrives a call, floor bells ring and everyone can hear them in the company, then everyone can answer 'capturing' the call m. - -- Maurizio Marini GSM +39-335-8259739 Work: +39-0721-855285 Fax +39-0721-859609 Home: +39-0721-950396 IAXTel: (700) 350-1234 -----BEGIN PGP SIGNATURE----- Version:

-----BEGIN PGP SIGNED MESSAGE----- Hash: SHA1 Hi there, i'm in debian sid 3.1 with kernel 2.6.7, * last cvs & chan_capi 0.3.4b; nt1+ with 2 bri in ptmp (http://www.voip-info.org/tiki-index.php?page=DDI) i tried to install avm c4 following step by step http://www.voip-info.org/tiki-index.php?page=Asterisk%20How%20to%20connect%20with%20CAPI step 1. i compiled capi 2.0 support in kernel

Hi i have an issue getting agentLogin working /etc/asterisk/queues.conf member => Agent/1001 member => Agent/1002 extension.conf exten => 110,1,Wait,1 exten => 110,2,AgentLogin() now, i call 110 by a firefly client, trying to login in as 1001 agent: Aug 12 16:31:36 DEBUG[1103408048]: chan_sip.c:4423 build_route: build_route: Contact hop: <sip:sip3@192.168.1.151:5060> --

Hey guys, I have what i think is a really simple problem :( I installed the seqinr library. I want to do an RSCU analysis. But i can't get it to work in even the simplest case. for example, if i have a string read in: > newdata5 $testseq [1] "agtgagatgatagatagatagatagatagatagatagaccccccagata" and then i perform an RSCU analysis on it... >

Here are the specifications from Excel 2010. There are others for older versions of Excel so you may need to do a search specific to your application. http://office.microsoft.com/en-us/excel-help/excel-specifications-and-limits-HP010342495.aspx?CTT=5&origin=HP005199291 You should be OK looking at these specs. However, in my experience Excel is a resource hog and this doesn't rule out

Hi All, I'm generating 10 different data sets with 1 and 0 in a matrix form and writing the output in separate files. Now I need to stack all these data sets in one vector and I know that stack only operates on list or data frame however I got these data sets by converting list to a matrix so can't go backwards now. Is there a way i can still use Stack? Please see the program:

Dear All: My apologies for sending this message to the wrong mailing list. I am indeed on the freebsd-stable list, as I use this OS, but the message was mistakenly sent to this forum. Sorry for disturbing your work. Let me take this opportunity to thank the developers for such a superb operating system. Best Regards, Davide -- Davide M. Marini, Ph.D. Research Fellow, Department of Cardiology

i'm not receiving any msg since april 5th. is there anything wrong? Marco Frattola (???) - Cubecom S.p.A. Via de Marini,1 3 piano Torre WTC 16149 GENOVA tel. 010 6591184

-----BEGIN PGP SIGNED MESSAGE----- Hash: SHA1 i fixed wrong capi.conf (there was [controller1] after [interfaces]) now capi.conf is: ; ; CAPI config ; [general] nationalprefix=0 internationalprefix=00 rxgain=0.8 txgain=0.8 [interfaces] msn=855285,859609 incomingmsn=* controller=1,2,3,4 softdtmf=0 accountcode= context=local ;echosquelch=1 ;echocancel=yes ;echotail=64 ;callgroup=1